Bridge-PCR-based method for detecting DNA hydroxymethylation

A hydroxymethylation and bridging technology, applied in the field of high-throughput and high-sensitivity detection, can solve the problem of difficult to accurately analyze the detection cost of specific base 5hmC, and achieve the effects of high repeatability, reduced test cost and good repeatability

Inactive Publication Date: 2013-11-13
XUZHOU MEDICAL COLLEGE
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although these detection methods can detect the fragment sequence of the 5hmC site in the whole genome and the distribution characteristics of 5hmC, they are prone to non-specific binding and cause false positive results due to antibody immunization, and it is difficult to accurately analyze the situation of specific base 5hmC and the cost of detection is high. shortcoming

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bridge-PCR-based method for detecting DNA hydroxymethylation
  • Bridge-PCR-based method for detecting DNA hydroxymethylation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Realized the detection of 10 CCGG sites (32131-40796) hmC in the spinal cord BDNF gene (Genbank ACCESSION: NT_039207) of mice with chronic inflammatory pain.

[0026] For the above 10 CCGG sites, design corresponding forward and reverse amplification primers for each site (the reverse primer is 27 bases long: the 7 bases near the 5' end are T, and the 20 bases near the 3' end are T The sequence after CGG (including CGG) of each CCGG site is reverse complementary. The amplification length of forward and reverse primers is 120bp;

[0027] The nucleotide sequences of the forward and reverse primer pairs of the above 10 CCGG sites are as follows:

[0028] (1) 32048-32167 F1 (T) 7 TACTGGGGCATATAAAGTT R1 (T) 7 ATGAACTAACCAGTACCCCG

[0029] (2) 32198-32317 F2 (T) 7 CCTTTAGCTCCTTGGCTACT R2 (T) 7 TCTCTTGTGAGACTATGCCG

[0030] (3) 32808-32927 F3 (T) 7 TATGAACATAGTGGAGCATG R3 (T) 7 AATTGGACATAGTACTACCG

[0031] (4) 34100-34219 F4 (T) 7 TACTGGGGCATATAAAGTT R4 (T) 7 GCTGA...

Embodiment 2

[0041] Achieved 9 CCGG sites (1222-3705) hmC of BDNF gene (Genbank ACCESSION: NC_000011.9) and 8 CCGG sites (771-15422) hmC of COMT gene (Genbank ACCESSION: NT_187012.1) in plasma DNA of patients with chronic rheumatoid pain simultaneous detection.

[0042] For the above 12 CCGG sites, design corresponding forward and reverse amplification primers for each site: the reverse primer is 27 bases long: the 7 bases near the 5' end are T, and the 20 bases near the 3' end are T The sequence after CGG (including CGG) of each CCGG site is reverse complementary. The amplification length of the forward and reverse primers is 120bp; the length of the forward primers is 20bp, and the 5' ends of the forward and reverse primers are both acryloyl-modified. Each pair of primers is diluted and mixed to 20uM, and fixed on the slide treated with acrylamide called a microarray chip.

[0043] The forward and reverse primer sequences for BDNF gene detection are as follows:

[0044] (1) 1222-1341 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a bridge-PCR-based high-flux chip detection method for DNA hydroxymethylation. . The detection method comprises: firstly fixing different forward primers for amplyfying DNA hydroxymethylation sites to a chip or a microballon; secondly using beta-glucanotransferase to glycosylating all 5hmC on DNA, then using MspI enzyme for enzyme digestion, wherein hydroxymethylated CCGG cannot be cleaved and non-hydroxymethylated CCGG can be cleaved; thirdly hybridizing genome DNA subjected to enzyme digestion with the chip, and performing bridge PCR, wherein the hydroxymethylated CCGG sites can have amplification because the hydroxymethylated CCGG cannot be cleaved, and conversely the non-hydroxymethylated CCGG sites cannot have amplification because the non-hydroxymethylated CCGG can be cleaved; and finally, according to presence or absence of fluorescence at different matrix points of the chip, determining whether CCGC at different positions of the genome DNA is subjected to hydroxymethylization. The beneficial effects comprises: parallelism detection on different DNA hydroxymethylization sites is realized, and the detection results have the characteristics of high flux and high sensitivity.

Description

technical field [0001] The invention belongs to a high-throughput and high-sensitivity detection technology for detecting DNA hydroxymethylation by using a chip. Background technique [0002] 5-Hydroxymethylcytosine (5hmC) is a newly discovered modified base (Kriaucionis and Heintz, 2009; Tahilianie et al., 2009), which exists in a variety of mammalian cell types at low levels. 5hmC is produced by enzymes of the 10-11 translocation (TET) family by oxidation of 5-methylcytosine (5mC). 5hmC can not only reduce the affinity between the methylation-binding domain (MBD) of MeCP protein and methylated DNA, but also has the potential transcriptional regulation function involved in the regulation of gene expression, and participates in the process of DNA demethylation. 5hmC may Become a new molecular marker for the diagnosis of certain diseases. Therefore, the research on 5hmC is increasingly favored by scholars. The research on 5hmC detection method is the premise and important ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68G01N21/64
Inventor潘志强曹君利郝凌云杨曦李燕强尹翠张松唐倩
OwnerXUZHOU MEDICAL COLLEGE