Novel drug targeting delivery adjuvant
An adjuvant and drug technology, applied in drug combinations, pharmaceutical formulations, genetic material components, etc., can solve the problems of human harm, low system transportation efficiency, low targeted transportation efficiency, etc. Good effect of targeted transport
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0040] The preparation method of the monosaccharide as in Examples 1-9 and 12 is as follows: use the pre-prepared sugar mother liquor to prepare a monosaccharide solution with a concentration of 50 mg / ml, and directly add the drug into the monosaccharide solution according to the dosage. Can.
[0041] For the mixed sugar solutions of Examples 10 and 11, to achieve a total sugar concentration of 100 mg / ml, then according to the ratio of 3:5:2, glucose, fructose, and sucrose should be 30 mg / ml, 50 mg / ml, and 20 mg / ml respectively. . According to the ratio of 4:2:1, glucose, fructose, and sucrose are required to be 57mg / ml, 29mg / ml, and 14mg / ml respectively.
[0042] The specific sequences of the above-mentioned drugs used are:
[0043] PMO 5′ggccaaacctcggcttacctgaaat3′
[0044]PNA 5′ggccaaacctcggcttacct3′
[0045] 2′OMe RNA 5′GGCCAAACCUCGGCUUACCU3′
[0046] P007 is a cell shuttling peptide, specifically disclosed in Human Molecular Genetics, 2008, Vol.17, No.24 3909-3918. ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap