Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel drug targeting delivery adjuvant

An adjuvant and drug technology, applied in drug combinations, pharmaceutical formulations, genetic material components, etc., can solve the problems of human harm, low system transportation efficiency, low targeted transportation efficiency, etc. Good effect of targeted transport

Inactive Publication Date: 2013-11-27
尹海芳
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] 1. Targeted transport efficiency is low;
[0011] However, the results of clinical tests and preclinical studies have shown that the low transport efficiency of the system is an urgent problem to be solved for various gene therapy drugs including antisense oligonucleotides, and the level of drug transport efficiency determines its therapeutic effect One of the key factors is also the bottleneck of current gene therapy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel drug targeting delivery adjuvant
  • Novel drug targeting delivery adjuvant
  • Novel drug targeting delivery adjuvant

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0040] The preparation method of the monosaccharide as in Examples 1-9 and 12 is as follows: use the pre-prepared sugar mother liquor to prepare a monosaccharide solution with a concentration of 50 mg / ml, and directly add the drug into the monosaccharide solution according to the dosage. Can.

[0041] For the mixed sugar solutions of Examples 10 and 11, to achieve a total sugar concentration of 100 mg / ml, then according to the ratio of 3:5:2, glucose, fructose, and sucrose should be 30 mg / ml, 50 mg / ml, and 20 mg / ml respectively. . According to the ratio of 4:2:1, glucose, fructose, and sucrose are required to be 57mg / ml, 29mg / ml, and 14mg / ml respectively.

[0042] The specific sequences of the above-mentioned drugs used are:

[0043] PMO 5′ggccaaacctcggcttacctgaaat3′

[0044]PNA 5′ggccaaacctcggcttacct3′

[0045] 2′OMe RNA 5′GGCCAAACCUCGGCUUACCU3′

[0046] P007 is a cell shuttling peptide, specifically disclosed in Human Molecular Genetics, 2008, Vol.17, No.24 3909-3918. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel drug targeting delivery adjuvant which is at least one of pentose, hexose, sugar alcohol and disaccharide, wherein the pentose is selected from at least one of xylose and arabinose; the hexose is selected from at least one of glucose, galactose, fructose and mannose; the disaccharide is selected from at least one of sucrose, lactose, maltose and mycose; the sugar alcohol is selected from at least one of sorbitol, mannitol, erythritol, maltitol, lactitol and xylitol. Furthermore, the invention provides an application of the novel drug targeting delivery adjuvant in drug delivery, especially in targeting delivery of antisense oligodeoxynucleotide drugs PMO, PNA, 2'ome RNA (Ribonucleic Acid), peptide-PMO and siRNAs as well as macromolecular plasmids. The adjuvant has a good targeting delivery effect, and is capable of remarkably enhancing the acting effect of a drug in a target tissue; the adjuvant, which is extracted from natural products, namely saccharides, is high in clinical safety index, basically free from hurt to human body, and low in or free from toxic and side effects.

Description

technical field [0001] The invention belongs to the field of life science and drug carrier. Background technique [0002] The targeted delivery efficiency of drugs is an important factor in determining the efficacy of drugs. The methods commonly used to optimize gene therapy drugs now include: optimizing the structure of the drug itself; using macromolecular polymers as transport carriers, the most common of which are nanomaterials; The use of tissue-targeting peptides, which covalently bind peptides to drugs. [0003] Among them, drug carriers are the most widely used, but the shortcomings of existing drug delivery carriers are: [0004] 1. Targeted transport efficiency is low; [0005] 2. There is potential harm to the human body. [0006] Take Duchenne muscular dystrophy as an example. Duchenne muscular dystrophy is a fatal neuromuscular disorder linked to human X chromosome inheritance. The incidence rate in newborn boys is 1:3500. consumption and degradation. If no...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K47/36A61K47/26A61K47/10A61K48/00A61P21/00
CPCA61K47/26A61K48/00A61P21/00C12N15/87
Inventor 尹海芳韩刚王青松
Owner 尹海芳
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products