Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Ti plasmid aspergillus niger gene replacement expression vector and application thereof

A gene replacement and expression carrier technology, applied in the field of molecular biology, can solve the problems of lack of commercial expression system, affect protein transport and secretion, protein accumulation, etc., achieve easy control of fermentation conditions, eliminate position effect and improve expression horizontal effect

Active Publication Date: 2013-11-27
NORTHEAST AGRICULTURAL UNIVERSITY +1
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The overexpressed heterologous protein exceeds the capacity of the cell, and the polypeptide chain cannot be folded correctly in time, resulting in the accumulation of misfolded or unfolded protein in the endoplasmic reticulum, which seriously affects the transport and secretion of the protein, which affects the low yield of heterologous protein important factor
[0004] Although some progress has been made in the study of filamentous fungal expression systems, there is still a lack of mature and commercial expression systems like E. coli expression systems and yeast expression systems
The key is the lack of simple and effective core and key technologies, such as high-efficiency transformation technology, high-efficiency gene replacement technology, selection marker gene deletion technology, homozygous transformant screening and identification technology, and the system integration of these technologies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ti plasmid aspergillus niger gene replacement expression vector and application thereof
  • Ti plasmid aspergillus niger gene replacement expression vector and application thereof
  • Ti plasmid aspergillus niger gene replacement expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1: Construction of pSZHG, pSZHGS, pSZHGF vectors

[0054] ① Construction of vector pSZH

[0055] The plant expression vector pBI121 (purchased from China Plasmid Vector Strain Cell Line Gene Collection Center was double-digested with NheI and EcoRI, see figure 1 ), recover a large fragment of about 9500bp, and connect it with a synthetic linker sequence (Adaptor1: 5'CTAGCAAGCTTCTCGAGGATCCTCTAGAG 3'; Adaptor2: 5'AATTCTCTAGAGGATCCTCGAGAAGCTTG3', synthesized by Shanghai Sangong), and construct the vector pSZH ( image 3 ).

[0056] ②Construction of vector pAN-Gla3

[0057] Using the genomic DNA of the glucoamylase-producing strain Aspergillus niger CICC2462 (purchased from the China Industrial Microbiology Culture Collection Management Center) as a template, GLA3-specific primers (GLA3SENCE1: BglII5' AGATCT ACAATCAATCCATTTCGCTATAGTT3':3; GLA3ANTISENCE1:XbaI5' TCTAGA CATAAGGCGGGTTCACATC3'; Shanghai Sangong Synthetics) for PCR amplification. A BglII site (show...

Embodiment 2

[0065] Example 2: High-efficiency secretion and expression of xylanase using food-grade Aspergillus niger expression system

[0066] (1) Construction of xylanase gene expression vector

[0067] ①Amplification of Aspergillus xylini glycanase gene xynB

[0068] Using Aspergillus niger CICC2462 genomic DNA as a template, xynB primers for xylanase gene (xynB-sense: 5'ApaI GGGCCC ACCATGCTCACCAAGAACCTTC3'; xynB-antisen:5'HindIII AAGCTT TTACTGAACAGTGATGGAC3'; Shanghai Sangong Synthetics) amplified the xynB gene and obtained a xynB gene fragment of about 746bp ( Figure 9 ). The MD18-gene fragment was connected with the cloning vector pMD18-T, transformed into Escherichia coli TOP10, extracted the plasmid pMD-xynB, and submitted for sequencing. The results showed that it was correct.

[0069] ② Construction of xylanase gene Aspergillus niger expression vector pSZHG–xynB

[0070] The plasmid pMD18-xynB was double-digested with ApaI and HindIII, and the target fragment of about 7...

Embodiment 3

[0089] Example 3: High-efficiency secretion and expression of mannanase using food-grade Aspergillus niger expression system

[0090] (1) Vector construction, the method is the same as in Example 2.

[0091] ①Amplification of mannanase gene MAN

[0092] Using the Aspergillus niger CICC2462 genomic DNA as a template, the mannanase gene MAN primer (MAN sense: 5'ApaI GGG CCC ACCATGGGGTCGTTAGAGGCTG3', MAN antisence5'EcoRV GATATCTTATTTTCGGTCCACTTGGTC3', Shanghai Sangong Synthetics) amplified about 1300bp MAN gene fragment, see PCR amplification results Figure 18 . The fragment was cloned into the vector pMD18-T to obtain the plasmid pMD-MAN, which was submitted for sequencing, and the results showed that it was correct.

[0093] ② Construction of Aspergillus niger expression vector pSZH-MAN

[0094] Use ApaI and EcoRV to double digest the plasmid pMD-MAN, recover the target fragment of about 1300bp, use ApaI and StuI to double digest the vector pSZHG, recover the target f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Ti plasmid aspergillus niger gene replacement expression vector and application thereof, and belongs to the technical field of molecular biology. The T-DNA (Triple helix Deoxyribose Nucleic Acid) region elements of the Ti plasmid aspergillus niger gene replacement expression vector are arranged in the following sequence: an aspergillus niger target gene promoter, a multiple cloning site, an aspergillus niger target gene terminator, an aspergillus nidulans 3-phosphoglyceraldehyde dehydrogenase gene promoter PgpdA, an aspergillus niger selection marker gene and an aspergillus niger target gene terminator. According to the invention, a target gene is integrated at the site of the aspergillus niger target gene through homologous recombination, and the target gene is regulated and controlled by a target gene promotor of high expression; therefore, the position effect of transgenosis is eliminated and the expression level is improved.

Description

technical field [0001] The invention relates to a Ti plasmid Aspergillus niger gene replacement expression carrier and an application thereof, belonging to the technical field of molecular biology. Background technique [0002] Since Mishra and Tatum first reported the DNA transformation of Neurospora crassa in 1973, fungal genetic transformation research has developed rapidly, and the PEG-CaCl 2 mediated genetic transformation, electrical shock-mediated genetic transformation, Agrobacterium-mediated genetic transformation and other methods. [0003] The main problem encountered in the production of heterologous proteins by filamentous fungi is that most of the proteins from mammals, plants and bacteria are far below the expression level of fungal endogenous proteins, usually only reaching tens of milligrams per liter of fermentation broth. However, the yield of expressed protein must be at least a few grams per liter to meet or meet the needs of industrial fermentation sca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/80C12N1/15C12R1/685
Inventor 李杰张会张莹莹刘君邓晨旭王泽芸陈璐璐何勇薛立新
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com