Ti plasmid aspergillus niger gene replacement expression vector and application thereof
A gene replacement and expression carrier technology, applied in the field of molecular biology, can solve the problems of lack of commercial expression system, affect protein transport and secretion, protein accumulation, etc., achieve easy control of fermentation conditions, eliminate position effect and improve expression horizontal effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1: Construction of pSZHG, pSZHGS, pSZHGF vectors
[0054] ① Construction of vector pSZH
[0055] The plant expression vector pBI121 (purchased from China Plasmid Vector Strain Cell Line Gene Collection Center was double-digested with NheI and EcoRI, see figure 1 ), recover a large fragment of about 9500bp, and connect it with a synthetic linker sequence (Adaptor1: 5'CTAGCAAGCTTCTCGAGGATCCTCTAGAG 3'; Adaptor2: 5'AATTCTCTAGAGGATCCTCGAGAAGCTTG3', synthesized by Shanghai Sangong), and construct the vector pSZH ( image 3 ).
[0056] ②Construction of vector pAN-Gla3
[0057] Using the genomic DNA of the glucoamylase-producing strain Aspergillus niger CICC2462 (purchased from the China Industrial Microbiology Culture Collection Management Center) as a template, GLA3-specific primers (GLA3SENCE1: BglII5' AGATCT ACAATCAATCCATTTCGCTATAGTT3':3; GLA3ANTISENCE1:XbaI5' TCTAGA CATAAGGCGGGTTCACATC3'; Shanghai Sangong Synthetics) for PCR amplification. A BglII site (show...
Embodiment 2
[0065] Example 2: High-efficiency secretion and expression of xylanase using food-grade Aspergillus niger expression system
[0066] (1) Construction of xylanase gene expression vector
[0067] ①Amplification of Aspergillus xylini glycanase gene xynB
[0068] Using Aspergillus niger CICC2462 genomic DNA as a template, xynB primers for xylanase gene (xynB-sense: 5'ApaI GGGCCC ACCATGCTCACCAAGAACCTTC3'; xynB-antisen:5'HindIII AAGCTT TTACTGAACAGTGATGGAC3'; Shanghai Sangong Synthetics) amplified the xynB gene and obtained a xynB gene fragment of about 746bp ( Figure 9 ). The MD18-gene fragment was connected with the cloning vector pMD18-T, transformed into Escherichia coli TOP10, extracted the plasmid pMD-xynB, and submitted for sequencing. The results showed that it was correct.
[0069] ② Construction of xylanase gene Aspergillus niger expression vector pSZHG–xynB
[0070] The plasmid pMD18-xynB was double-digested with ApaI and HindIII, and the target fragment of about 7...
Embodiment 3
[0089] Example 3: High-efficiency secretion and expression of mannanase using food-grade Aspergillus niger expression system
[0090] (1) Vector construction, the method is the same as in Example 2.
[0091] ①Amplification of mannanase gene MAN
[0092] Using the Aspergillus niger CICC2462 genomic DNA as a template, the mannanase gene MAN primer (MAN sense: 5'ApaI GGG CCC ACCATGGGGTCGTTAGAGGCTG3', MAN antisence5'EcoRV GATATCTTATTTTCGGTCCACTTGGTC3', Shanghai Sangong Synthetics) amplified about 1300bp MAN gene fragment, see PCR amplification results Figure 18 . The fragment was cloned into the vector pMD18-T to obtain the plasmid pMD-MAN, which was submitted for sequencing, and the results showed that it was correct.
[0093] ② Construction of Aspergillus niger expression vector pSZH-MAN
[0094] Use ApaI and EcoRV to double digest the plasmid pMD-MAN, recover the target fragment of about 1300bp, use ApaI and StuI to double digest the vector pSZHG, recover the target f...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap