Quininone reductase and application thereof to asymmetric synthesis of (R)-3-quinuclidinol

A technology of quinine ketone and reductase, which is applied in the field of quinine reductase and its application in the asymmetric synthesis of (R)-3-quinine alcohol, can solve the problem of unsuitable for industrial production, low product concentration, The low activity of the enzyme itself has achieved good industrial application prospects, high product concentration, and easy operation.

Active Publication Date: 2014-02-05
EAST CHINA UNIV OF SCI & TECH
View PDF2 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the above method is limited to the laboratory scale, and there are defects such as low enzyme activity, low product concentration, and long reaction time, so it is not suitable for industrialized production of (R)-3-quinine alcohol (generally requiring that the product concentration should be between 100g / L or more)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quininone reductase and application thereof to asymmetric synthesis of (R)-3-quinuclidinol
  • Quininone reductase and application thereof to asymmetric synthesis of (R)-3-quinuclidinol
  • Quininone reductase and application thereof to asymmetric synthesis of (R)-3-quinuclidinol

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach

[0038] The present inventor carried out the functional measurement of quinine reduction from the wild bacteria preserved in this laboratory, and selected the strains capable of reducing 3-quinine to generate (R)-3-quinine alcohol, obtained by the shotgun method. The asymmetric catalytic reduction of 3-quinine ketone to generate (R)-3-quinine alcohol gene, thus completing the present invention.

[0039] The present invention is further illustrated below by means of examples, but the present invention is not limited thereto. For the experimental methods that do not specify specific conditions in the following examples, select according to conventional methods and conditions, or according to the product instructions.

[0040] The sources of material in the following examples are:

[0041] Agrobacterium radiobacter CGMCC7986.

[0042] The expression plasmid pET28a was purchased from Shanghai Novagen Company.

[0043] E.coli DH5α and E.coli BL21(DE3) competent cells, 2×Taq PCR M...

Embodiment 1

[0045] Embodiment 1 Wild-type Agrobacterium radiata catalyzes the asymmetric reduction of 3-quininone

[0046] Agrobacterium radiobacter (Agrobacterium radiobacter) CGMCC7986 was cultured at 30°C for 2 days in a medium containing peptone 5g / L, meat extract 3g / L, pH 7.0. Gained culture fluid is centrifuged to obtain thalline precipitation, and the wet cell of Agrobacterium radiatus described in 10g / L is used as a biocatalyst, and when the substrate concentration is 10mM, the conversion rate of quinine can be made to reach 93% within 12 hours , the optical purity of the product is 99%ee(R).

[0047] Cloning of embodiment 2 quinine reductase gene

[0048] Based on the open reading frame obtained by shotgun cloning, the PCR primers were designed as follows:

[0049] Upstream primer: GAATTC CATATG GAGGCTTCATTGTCGG;

[0050] The downstream primer is: CGC GGATCC TCAGTCCATGCGAACGCCAC

[0051] Wherein, the underlined part in the upstream primer is the NdeI restriction site, and...

Embodiment 3

[0053] Embodiment 3 Preparation of recombinant expression plasmid and recombinant expression transformant

[0054] The PCR product containing the quinine reductase gene obtained in Example 2 was double-digested with restriction endonucleases NdeI and BamHI at 37°C for 12 hours, purified by agarose gel electrophoresis, and purified using an agarose gel DNA recovery reagent box to recover the target fragment. Under the action of T4 DNA ligase, the target fragment was ligated with the vector plasmid pET28a digested with NdeI and BamHI at 4°C overnight to obtain the recombinant expression plasmid pET-ArQR.

[0055] Transform the above-mentioned recombinant expression plasmid into Escherichia coli (E.coli) DH5α competent cells, screen the positive recombinants on the resistance plate containing kanamycin, pick a single clone, and the colony PCR verification is positive clone. Cultivate the recombinant bacteria, extract the plasmid after the plasmid is amplified, retransform into ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses anagrobacterium radiobacter, a quininone reductase expressed thereby and a gene thereof, recombinant expression plasmid containing the gene, recombinant expression vector containing the gene, a recombinase of quininone, a preparation method of the recombinase , and application of the recombinase to asymmetric reduction of 3-quininone as a catalyst for preparation of (R)-3-quinuclidinol. Compared with other preparation methods for (R)-3-quinuclidinol, the (R)-3-quinuclidinol prepared by employing the quininone reductase provided by the invention is not only high in product concentration, but also good in optical purity; the reaction condition is mild, the operation is convenient, and the preparation is easy to amplify; and therefore the application of the quininone reductase to asymmetric synthesis of (R)-3-quinuclidinol has extremely good industrial application prospect in the production of intermediates of anticholinergic drugs.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to an Agrobacterium radiobacter (Agrobacterium radiobacter) CGMCC7986, a quinine reductase expressed by the Agrobacterium radiobacter and its gene, a recombinant expression vector containing the gene and a recombinant expression transformant , and its recombinant enzyme and the preparation method of the recombinant enzyme, and also relates to the application of the quinine reductase or its recombinant enzyme as a catalyst in the asymmetric reduction of 3-quinine to prepare (R)-3-quinine alcohol . Background technique [0002] (R)-3-quinine alcohol (molecular formula is C 7 h 13 NO, molecular weight 127.18, CAS number: 25333-42-0) is an important chiral building block for the synthesis of various anticholinergic drugs (such as tasalidine, ravatorate, etc.). These drugs are mainly used in the treatment of chronic obstructive pulmonary disease and Alzheimer's dise...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12N9/02C12N15/53C12N15/63C12N1/21C12P17/18C12R1/01
Inventor许建和郁惠蕾张文霞潘江
OwnerEAST CHINA UNIV OF SCI & TECH