Fusion protein inhibiting the formation of taci-baff complex and its preparation method and use

A fusion protein, application technology, applied in the direction of peptide/protein components, DNA/RNA fragments, cells modified by introducing foreign genetic material, etc., can solve the impact of humoral immune response, autoreactive B cell autoimmune tolerance destruction, etc. question

Active Publication Date: 2017-05-03
SHANGHAI KANDA BIOTECHNOLOGY CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Overexpression of BAFF has the potential to be involved in the generation of autoreactive B cells and the breakdown of autoimmune tolerance, i.e., alterations in BAFF signaling can affect humoral immune responses, leading to autoimmune diseases or tumors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein inhibiting the formation of taci-baff complex and its preparation method and use
  • Fusion protein inhibiting the formation of taci-baff complex and its preparation method and use
  • Fusion protein inhibiting the formation of taci-baff complex and its preparation method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0114] Construction of Fusion Protein A Expression Plasmid

[0115] The fusion protein A precursor (Figure 4) is composed of the following three-part fragments from the N-terminal to the C-terminal, and the specific amino acid sequence is as follows:

[0116] Fragment 1. The amino acid sequence of TNF-R2 is from position 1 to position 76, including the first cysteine-rich region ( figure 2 ).

[0117] Fragment 2. The amino acid sequence of TACI is from the 30th to the 119th, containing two cysteine-rich regions and part of the main stem sequence ( figure 1 ).

[0118] Fragment 3. The human γ1 amino acid sequence is from 216th to 447th, containing a hinge region and two CH regions ( image 3 ).

[0119] Synthesis of fragment 1 cDNA. The PCR template is human cDNA prepared by conventional methods. The primer AAGCTTGCGGCCGCGAGCTCGGATCCACT (SEQ ID NO.: 6) at the 5' end is the sequence of the plasmid vector. For cloning into the pT vector, a Not I restriction site was in...

Embodiment 2

[0124] Construction of Fusion Protein B Expression Plasmid

[0125] The fusion protein B precursor (Figure 4) is composed of the following three parts from the N-terminal to the C-terminal, and the specific amino acid sequence is as follows:

[0126] Fragment 1. The human CD33 protein signal peptide contains the first 16 amino acids at the N-terminus.

[0127] Fragment 2. The TACI amino acid sequence is from 30th to 119th, containing two cysteine-rich regions and part of the main stem sequence ( figure 1 ).

[0128] Fragment 3. The amino acid sequence of human IgG1 is from 216th to 447th, containing a hinge region and two CH regions ( image 3 ).

[0129] The recombinant gene encoding fusion protein B was constructed by overlapping polymerase chain reaction (PCR). The template for the PCR reaction was human cDNA prepared by a conventional method. Polymerase chain reaction (PCR) was carried out with PlantiumSuperMix of Invitrogen Company, according to the manufacturer's i...

Embodiment 3

[0136] Establishment of fusion protein expression cell lines

[0137] In this example, a stable and high-efficiency protein expression CHO DG44 cell line was established by means of stable transfection and gene amplification. The cloned CHO DG44 cells were cultured in suspension in serum-free, animal protein-free medium.

[0138] The original CHO DG44 cells were obtained from Invitrogen Company, and the methods of cell culture and subculture were referred to the company's operation manual. Non-transfected cells were cultured in suspension in CD DG44 medium containing 8mM Glutamine and 0.18% Fluronic F-18.

[0139] A large number of expression plasmids encoding the fusion protein were prepared using Qiagen's kit. In order to prevent the plasmid from being contaminated by bacteria, the plasmid was purified once by alcohol precipitation. Before gene transfection, CD DG44 cells were passed for three generations before transfection. When the cell density reaches 1×10 6 / ml, tr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention provides a fusion protein for inhibiting formation of a TACI-BAFF complex and a preparation method and application thereof. Specifically, the fusion protein provided by the invention has high biological activity for enclosing BAFF / APPRIL, can significantly reduce serum IgM concentration of the normal Balb / c mice, and serum IgM and IgE concentration of C57 / B6 of asthmatic mice. The TACI-Fc fusion protein provided by the invention can be used for the treatment of autoimmune diseases, including asthma, systemic lupus erythematosus and rheumatoid arthritis, also can be used for the treatment of diseases related to B cell increase, such as multiple myeloma, chronic lymphocytic leukemia, macroglobulinemia and plasma cell leukemia.

Description

technical field [0001] The present invention relates to the field of biology and medicine, and more specifically relates to a fusion protein (such as TACI-Fc fusion protein) inhibiting the formation of TACI-BAFF complex and its preparation method and application. Background technique [0002] TNF and its receptor superfamily members play an important role in the body's defense, inflammatory response, immune regulation and other processes. They can act in membrane-bound or soluble form through paracrine, autocrine and endocrine, and can cause a series of biological effects when combined with corresponding receptors. [0003] TNF family receptors are generally type I transmembrane proteins consisting of several extracellular regions containing cysteine-rich domains (CRDs) and an intracellular region containing binding sites for TRAF proteins, which in some cases Also contains dead structures. [0004] Human TACI (transmembrane activator and calcium modulator and cyclophilinl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N5/10C12N1/15C12N1/19C12N1/21C12P21/02A61K38/17A61P37/02A61P11/06A61P29/00A61P19/02A61P35/02
Inventor 蔡则玲陈羿吴珩王进张静方国波
Owner SHANGHAI KANDA BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products