Application of SCWBC11 protein in culture of male sterility line of rice

A male sterility, protein technology, applied in the application, the use of vectors to introduce foreign genetic material, and cells modified by the introduction of foreign genetic material, etc., can solve problems such as failure to achieve three-line matching and limited application.

Active Publication Date: 2014-06-04
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because the segregation ratio of fertile and sterile in the F1 generation is 1:1, dominant genic sterile rice usually has neither restorer nor maintainer lines, so it cannot be directly used for production; Sexual genic male sterility and polygenic recessive genic male sterility, these types of sterile lines are difficult to find corresponding maintainer lines in production, and three-line matching cannot be realized, which limits their application in the use of heterosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of SCWBC11 protein in culture of male sterility line of rice
  • Application of SCWBC11 protein in culture of male sterility line of rice
  • Application of SCWBC11 protein in culture of male sterility line of rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1, Phenotype and Genetic Analysis of Rice Male Sterility Mutant wbc11

[0034] 1. Phenotype analysis of male sterile mutant wbc11

[0035] The rice male sterile mutant wbc11 was obtained by treating wild-type Nipponbare seeds with ethyl methanesulfonate (EMS). The wbc11 mutant has no significant difference compared with the control Nipponbare in the vegetative growth stage, and the mutant shows a typical male sterile phenotype after heading. normal seed ( figure 1 , where A is the plant at the heading stage; B is the ear at the mature stage; C is the anther at the pollen mature stage). The pollen of the wbc11 mutant was granted to the wild type, and it was found that it can bear fruit normally, and the hybrid seeds can germinate and grow normally, and the plants have no significant difference from the wild type in terms of survival rate, vegetative growth, reproductive growth, etc., indicating that the mutant Females are fertile.

[0036] 2. Observation and ...

Embodiment 2

[0042] Embodiment 2, map-based cloning of OsWBC11 gene

[0043]In order to clone the OsWBC11 gene, the preliminary mapping of the OsWBC11 gene was performed on 54 male sterile recessive individuals wbc11 in the F2 population. Using the STS markers saved in the laboratory, the OsWBC11 gene was located in the range of about 500K between physical positions 18.47 (Ac09120-28) and 18.96 (Ac068923-75) of the long arm of chromosome 10 by using the PCR method. Next, in order to perform a finer mapping of the WBC11 gene, 338 mutant phenotype plants were obtained from the F3 population, and multiple STS markers were newly designed (Table 2). After analyzing the STS markers of the F3 population, the OsWBC11 gene was finally positioned between the two STS markers, Ac023240-45 and Ac068950-97, with a physical distance of about 180kb ( image 3 , A. Schematic diagram of map-based cloning of OsWBC11. B. OsWBC11 gene structure diagram and mutation location, black rectangles represent exons,...

Embodiment 3

[0048] Example 3, Functional Verification of OSWBC11 Gene

[0049] 1. Obtaining the RNA interference recombinant vector

[0050] Japonica rice (Nipponbare) (The Plant Cell, Vol.24:577–588, February 2012; the public can obtain it from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, hereinafter also referred to as wild-type rice) Spike cDNA was used as a template, and the following primers CTCGAGTGCTTCAGCGTTCTTCGTG and GGATCCGTGCCATCTCATTGACTTTC were used for PCR amplification to obtain a PCR product of about 430 bp. After sequencing, the PCR product had sequence 1 in the sequence table from nucleotides 739 to 1157 at the 5' end and additions at both ends Restriction site Xho I and BamH I, the PCR product named forward fragment.

[0051] The 430bp PCR product (the 3' protruding sticky-end fragment with base A at 3') was purified with the Biomed Gel Extraction Kit (Biomed, 28706) according to the product instructions, and then ligated with the p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a SCWBC11 protein in culture of a male sterility line of rice, and provides an application of a substance which is expressed by an OSWBC11 protein coding gene in a silent or inactivated target plant to culture of a male sterile plant. In the application, the amino acid sequence of the OSWBC11 protein is the sequence 2 in the sequence table. The target plant is dicotyledon or monocotyledon and monocotyledon is specifically rice. Experiments verify that by adopting an RNA (Ribonucleic Acid) interference method, OSWBC11 protein expression interference is carried out on wild rice Nipponbare, so that the protein function is lost and rice cannot produce pollen, thereby forming the male sterility line. Therefore, the protein has an important application value to the forming mechanism of pollen of rice and the application of the protein to crossbreeding of rice can be explored.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of an OSWBC11 protein in cultivating male sterile lines of rice. Background technique [0002] Rice is one of the three major food crops in the world, and about half of the world's population uses rice as the main food. China's rice cultivation area accounts for about 23% of the world's total, and its rice production accounts for about 37% of the world's total. China's rice planting area accounts for 30% of the country's grain crop planting area, but the total output accounts for more than 42% of the grain crop output, and the average yield per unit area is 45.7% higher than that of the entire grain crop. One of the important reasons is the heterosis. widely used. Heterosis is a common phenomenon in the biological world. It refers to the hybridization of two genetically different parents. Hybrid rice shows significant heterosis in many traits, comprehensively manif...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/11C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21A01H5/00
Inventor程祝宽刘程捷李明唐丁王克剑马伯军
OwnerINST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI