Gamma-polyglutamic acid production gene engineering bacterial and method for producing high-yield gamma-polyglutamic acid through gamma-polyglutamic acid production gene engineering bacterial

A technology of genetically engineered bacteria and genetically engineered strains, applied in the field of bioengineering, can solve the problems of low PGA concentration, reduced dissolved oxygen concentration of fermentation broth, low yield of γ-polyglutamic acid, etc.

Active Publication Date: 2014-06-25
SHANDONG FREDA BIOTECH
View PDF3 Cites 26 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, in the process of producing γ-polyglutamic acid by fermentation, the anabolic pathway is relatively complicated, the concentration of PGA in the fermentation broth is relatively low, and the fermentation broth is extremely viscous, with a viscosity of several thousand milliPascals, and the high viscosity of the fermentation broth is significantly reduced. The concentration of dissolved oxygen in the fermentation broth is reduced, forming a hypoxic environment, and the very limited available oxygen becomes a key factor limiting the production and metabolism of the production strain, which greatly affects the metabolic growth of the strain and reduces the γ-polyglutamine Acid synthesis secretion, resulting in lower yields of γ-polyglutamic acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gamma-polyglutamic acid production gene engineering bacterial and method for producing high-yield gamma-polyglutamic acid through gamma-polyglutamic acid production gene engineering bacterial
  • Gamma-polyglutamic acid production gene engineering bacterial and method for producing high-yield gamma-polyglutamic acid through gamma-polyglutamic acid production gene engineering bacterial
  • Gamma-polyglutamic acid production gene engineering bacterial and method for producing high-yield gamma-polyglutamic acid through gamma-polyglutamic acid production gene engineering bacterial

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Embodiment one : Construction of pSK(-)-P43-vgb recombinant vector expressing hemoglobin gene

[0020] Using conventional molecular biology techniques, the nucleotide sequences 1-500 and 1381-1984 of the 5' end of the Bacillus subtilis amylase gene were cloned into the pBluescriptsk (-) plasmid respectively. Xho I, Hind III and XbaⅠ, SacⅡ between the sites; the primers used were:

[0021] AmyE1 5'ATTGCTCGAGATGTTTGCAAAACGATTCAAA3'

[0022] AmyE2 5' GGATAAGCTTTGTGTGTTTCCATGTGTCCAGT3'

[0023] AmyE3 5' ATTGTCTAGAGCTGTGCTTTATCCTGATGATA3'

[0024] AmyE4 5' ATTACCGCGGTCAATGGGGAAGAGAACCGCT3'

[0025] Using the Bacillus subtilis genome as a template, the

[0026] P1 5' ATTAGAATTCTGTCGACGTGCATGCAGGC3'

[0027] P2 5' TAGGATCCTATAATGGTACCGCTATCACT3'

[0028] Use primers to amplify the P43 promoter gene by PCR; insert it into the pBluescriptsk (-) plasmid EcoRI with BamHI between sites;

[0029] With pUC19-vgb as template, with

[0030] VGB1 5'ATTGGATCCGGAAGACCCTCA...

Embodiment 2

[0037] Embodiment two : High-yield γ-polyglutamic acid engineering bacteria Bacillus subtilis ( Bacillus subtilis ) The construction of the FRD518

[0038] The vector pSK(-)-P43-vgb constructed in Example 1 was used with restriction endonuclease XhoI or SacⅡ Linearized; dephosphorylated with alkaline phosphatase and recovered for electrotransformation. The specific method is as follows:

[0039] (1) Vaccination B. subtilis In 3ml LB medium, cultivate overnight. (2) Take 2.6ml of overnight culture and inoculate into 40ml (LB+0.5M sorbitol), culture at 37℃, 200rpm until OD600=0.85~0.95. (3) Place the bacterial solution in an ice-water bath for 10 min, then centrifuge at 5000 g for 5 min at 4°C to collect the bacterial cells. (4) Use 50ml of pre-cooled electroporation medium (0.5M sorbitol, 0.5M mannitol, 10% glucose), re-suspend the bacteria, centrifuge at 5000g, 5min, 4°C to remove the supernatant, and rinse 4 times in this way. (5) Suspend the washed cells in 1ml ...

Embodiment 3

[0040] Embodiment Three : Screening and verification of high-yield γ-polyglutamic acid by genetically engineered strain FRD518

[0041] Pick 36 fast-growing positive clone strains, and select the strain with the highest viscosity of the fermentation liquid after shake-flask fermentation screening, named as Bacillus subtilis FRD518. The original strain and Bacillus subtilis FRD518 were respectively inoculated into 250ml Erlenmeyer flasks containing 50ml seed medium, cultured overnight at 37°C, and the shaker speed was 210rpm. The cultured seeds were inoculated into 250ml Erlenmeyer flask containing 50ml fermentation medium with 2% inoculum amount, cultured at 37°C for 48~72h, and the shaker speed was 210rpm. After the fermentation, take 1ml of fermentation broth, dilute it 10 times, centrifuge at 12000r / min, 4°C for 10min, take the supernatant, filter it through a microporous membrane, and perform chromatographic analysis. The chromatographic analysis conditions are: c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a high-yield gamma-polyglutamic acid production gene engineering bacterial and a fermentation production method thereof. The gene engineering bacterial is named Bacillus subtilis FRD518, wherein the preservation number is CGMCC NO.6772, and the Vitreoscilla hemoglobin gene (vgb) is recombined and integrated on the chromosome of the gene engineering bacterial, such that the Vitreoscilla hemoglobin VHb can be successfully and highly expressed so as to significantly improve the oxygen utilization rate of the recombinant Bacillus subtilis under a low dissolved oxygen condition. According to the present invention, during a fermentation process, a carbon source, sodium glutamate, a yeast extract and other components are added in a flow manner, such that the gene engineering bacterial can efficiently produce the gamma-polyglutamic acid in a high yield manner, wherein the yield achieves more than 65 g / L, and is increased by 147% compared with the yield of the single batch culture of the original wild strain; and with the gene engineering bacterial, the problems of low yield, more by-products, long period, high energy consumption and the like of fermentation of the gamma-polyglutamic acid gene engineering bacterial under high viscosity and dissolved oxygen limiting conditions are solved, and the gamma-polyglutamic acid gene engineering bacterial can be applied for large-scale industrial production of gamma-polyglutamate acid.

Description

technical field [0001] The invention relates to a high-yield gamma-polyglutamic acid engineering strain transformed by genetic engineering technology and a method for fermenting and producing gamma-polyglutamic acid using the engineering strain, which belongs to the technical field of bioengineering. Background technique [0002] γ-polyglutamic acid (poly-γ-glutamic acid, poly-γ-glutamic acid, referred to as PGA) is an amino acid polymer synthesized by microorganisms, which is composed of L- or / and D-glutamic acid through γ- It is formed by linking polyglutamyl bonds, and its molecular weight is generally between 100 and 1000KDa, which is equivalent to about 500 to 5000 glutamic acid monomers. γ-polyglutamic acid has excellent film-forming properties, fibrinating properties, plasticity, cohesiveness and extremely strong water absorption. Knot and strong water absorption and other functions. As a biological material, γ-polyglutamic acid has the advantages of good biodegrada...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P13/02C12R1/125
Inventor李海军苏移山朱希强张晓元颜震王林凌沛学
OwnerSHANDONG FREDA BIOTECH