Expression method and purification of mouse epidermal growth factor in pichia pastoris
A technique for epidermal growth factor and expression method, which is applied in the field of expression method and purification of mouse epidermal growth factor in Pichia pastoris GS115, and achieves the effect of simple purification and large-scale processing.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0013] Example 1 : Construction of recombinant plasmid pBSAZ 2.1
[0014] 1) Test material
[0015] (1) Plasmids and strains
[0016] Plasmids pPIC 9k, pMAL-p5X and Escherichia coli JM109 were purchased from Takara Biotechnology Co., Ltd.
[0017] (2) Reagents
[0018] restriction endonuclease Eco R I and not I, kanamycin and kanamycin were purchased from NEB Company.
[0019] The gene fragment mEGF and primers were synthesized by BGI.
[0020] m-F: CGGAATTCAATAGTTATCCAGGAT
[0021] m-R: TAATGCTCCTGCTGCGAACTCCTCTAGTAACTGGAAATAGGTTCTC
[0022] M-F: GAGAACCTATATTTCCAGTTACTAGAGGAGTTCGCAGCAGGAGCATTAAAAAATAAAAAACAGGT
[0023] M-R:
[0024] ATAAGAATGCGGCCGCCGCTGCTGTGATGATGATGATAGTCTGCGCGTC
[0025] 2) Implementation plan
[0026] 1. Digestion of plasmid pPIC9k
[0027] Extract a large amount of reconstituted plasmid pPIC 9k, add restriction endonuclease after purification Eco R I and not I. Place in a constant temperature incubator at 37°C for 2-3 hours for doubl...
Embodiment 2
[0038] Example 2: Electrotransformation of Pichia pastoris
[0039] 1. Linearization of recombinant plasmid pBSAZ 2.1
[0040] Recombinant plasmid pBSAZ 2.1 using restriction enzymes Bgl ПLinearization, after purification and recovery, perform 1% agarose gel electrophoresis to confirm the correctness of the purified and recovered fragments.
[0041] 2. Preparation of Competent Cells
[0042] A single colony of Pichia pastoris GS115 was picked and inoculated into a shake flask containing 50 mL of YEPD medium at 30°C and 150 rpm for overnight cultivation. Take 100 μL of the culture and transfer it to a shaker flask containing 50 mL of fresh YEPD medium at 30 ° C, 150 rpm, and measure the OD600 value. When it reaches 1.3-1.5, pour the cell culture into a pre-cooled sterile 50 mL centrifuge tube, Centrifuge at 4000rpm for 5min at 4°C. Under sterile conditions, resuspend the bacterial pellet with 50 mL of pre-cooled sterile water for each tube. Centrifuge at 4000rpm for 5...
Embodiment 3
[0045] Example 3 : Screening of positive recombinant strains
[0046] 1. Using Pichia pastoris GS115 histidine auxotrophy to screen integrated recombinant bacteria
[0047] Centrifuge the static cultured bacterial solution at 1500rpm for 5 minutes, spread it on an MD plate, and culture it in a constant temperature incubator at 30°C for 2-3 days until a single colony grows.
[0048] 2. G418 resistance screening for high copy strains
[0049] Use toothpicks to inoculate the colonies grown on the MD plate onto 1.5mg / ml-2mg / ml G418 YEPD plates, and culture them in a constant temperature incubator at 30°C for about three days. Select the longer and larger colonies to inoculate with 1.5mg / ml-2mg / ml G418 YEPD liquid medium, cultivate overnight on a shaker at 30°C, and store the strain at -80°C.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
