Genetically engineered bacterium for efficiently expressing catechins as well as construction method and application thereof

A genetically engineered bacteria, high-efficiency expression technology, applied in microorganism-based methods, biochemical equipment and methods, bacteria, etc., can solve problems such as safety risks, consumption of large tea leaves, and organic reagents affecting the quality of finished products.

Inactive Publication Date: 2014-07-02
ANHUI AGRICULTURAL UNIVERSITY
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The above methods are the improvement of the early traditional chemical separation method, the main disadvantage is that a large amount of tea leaves need to be consumed to obtain a small amount of fine products; at the same time, a large amount of organic reagents need to be used in the purification process to affect the quality of the finished product, which also leads to potential safety hazards. sexual risk

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium for efficiently expressing catechins as well as construction method and application thereof
  • Genetically engineered bacterium for efficiently expressing catechins as well as construction method and application thereof
  • Genetically engineered bacterium for efficiently expressing catechins as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Construction of Genetically Engineered Bacteria Highly Expressing Catechin

[0027] 1) Amplification of DFR and LAR sequences

[0028] According to the registered DFR and LAR sequences, design double restriction primers to amplify the sequences with Xho I and Nde I restriction sites.

[0029] The primer sequence corresponding to DFR is DFR-Nde I / F: CATATGATGAAAGACTCTGTTGC, DFR-Xho I / R: CTCGAGTTAAACCTTGTTGCCATTG;

[0030] The primer sequence corresponding to LAR is LAR-Nde I / F: CATATGATGACTGTGTTGGAATCTG, LAR-Xho I / R: CTCGAGTCAAAGCACACATTGTGATG;

[0031] The tea tree cDNA was used as a template, and the above primers were used for amplification.

[0032] Among them, the PCR reaction system is: 1 μL template, 10 μL 5×buffer, 0.5 μL high-fidelity enzyme, 4 μL dNTP Mix, 1 μL upstream and downstream primers, 32.5 μL sterile water. The PCR amplification conditions were: 98°C for 10s, 62°C for 15s, and 72°C for 30s. After the program ends, the product is recovered...

Embodiment 2

[0039] Example 2 Utilize the genetically engineered bacteria of Example 1 to produce catechins

[0040] 1) Inoculate the constructed genetically engineered bacteria into 20 mL of LB medium containing 50 μg / mL Kan and 50 μg / mL Amp, cultivate overnight at 37°C and 200 rpm; and 50 μg / mL Amp LB medium, cultivated to OD600=0.5; adding IPTG with a final concentration of 1 mmol / L to induce at 28°C for 5 hours.

[0041] 2) Preparation of catechins: Substrate DHQ was added to the above cultured bacterial solution, and the culture was continued overnight. Centrifuge at 4°C and 5000 rpm to take the supernatant, extract with an equal volume of ethyl acetate, and then perform rotary evaporation with a rotary evaporator to obtain catechin powder. After the methanol is dissolved, it is detected by high performance liquid phase, and the detection results are as follows: figure 2 shown.

[0042] Depend on figure 2It can be seen that (C is catechin), the bacterial strain of the present in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a genetically engineered bacterium for efficiently expressing catechins as well as a construction method and application thereof. The genetically engineered bacterium carries two foreign genes including dihydroflavonol4-reductase (DFR) and leucoanthocyanidin reductase (LAR), and can be used for efficiently generating catechins.

Description

technical field [0001] The invention relates to a genetically engineered bacterium capable of efficiently expressing catechin, belonging to the field of bioengineering. Background technique [0002] Catechin is an important component in tea, also known as catechin and tea tannin. It is a kind of flavanol derivatives. It is formed from sugars through a series of enzymes and through the shikimic acid pathway to form benzene ring compounds. It is then synthesized by a series of enzymes. Existing studies have confirmed that catechin has various functions such as preventing and treating cardiovascular diseases and cancer; d-catechin can also reduce the permeability of capillaries, stop diarrhea, stop bleeding, anti-virus, fungicide, and inhibit ACE And prevent gastric ulcer; at the same time, catechin is a reducing polyphenolic substance, which is easily oxidized by air in aqueous solution and is often used as an antioxidant. [0003] In the prior art, solvent extraction is the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12P17/06C12R1/19
Inventor王云生胡晓婧夏涛高丽萍许玉娇
OwnerANHUI AGRICULTURAL UNIVERSITY