Unlock instant, AI-driven research and patent intelligence for your innovation.

Spirulina platensis CPD (cyclobutane pyrimidine dimer) photolyase and application thereof

A technology of Spirulina platensis and photoreparation enzyme, which is applied in the biological field, can solve the problems of separation, purification and in vitro application difficulties, and achieves the effect of repairing DNA damage of skin cells, which is of great significance, huge social benefit and economic value.

Inactive Publication Date: 2014-08-06
ANHUI BIOYEARNING BIO ENG
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a safe edible algae, each Spirulina platensis contains only 10-20 CPD photorepair enzyme molecules, which makes it extremely difficult to directly isolate, purify and apply in vitro the natural Spirulina platensis CPD photorepair enzyme

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Spirulina platensis CPD (cyclobutane pyrimidine dimer) photolyase and application thereof
  • Spirulina platensis CPD (cyclobutane pyrimidine dimer) photolyase and application thereof
  • Spirulina platensis CPD (cyclobutane pyrimidine dimer) photolyase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Acquisition of optimized prokaryotic expression encoding gene of Spirulina platensis CPD photorepair enzyme

[0046] The original cDNA sequence of Spirulina platensis CPD photorepair enzyme (Gene ID: 15162397) was queried from the GeneBank database. According to the tRNA abundance data in E. coli cells, the rare triplet in the original coding gene of Spirulina platensis CPD photorepair enzyme The body codon was replaced with the corresponding codon nucleotide with the highest abundance of tRNA in E. coli cells, and finally the optimized gene coding sequence of Spirulina platensis CPD photorepair enzyme suitable for prokaryotic expression in E. coli was obtained. During the optimization process, 367 nucleotides were substituted and adjusted in the original cDNA sequence of the CPD photorepair enzyme of Spirulina platensis, accounting for 25% of the coding sequence, which has the nucleotide sequence shown in SEQ ID NO:1.

Embodiment 2

[0047] Example 2 Construction of Expression Vector of Spirulina platensis CPD Photorepair Enzyme

[0048] 1. Design primers based on the complete sequence of the optimized Spirulina platensis CPD photorepair enzyme gene:

[0049] Forward primer: CGACGCATATGGCTGCTAACCCGCAG

[0050] Reverse primer: GACACTCGAGTTAGGTCATACGCAGAGC

[0051] The PCR reaction conditions were: pre-denaturation at 98°C for 10 min, denaturation at 98°C for 50 s, annealing at 55°C for 50 s, extension at 72°C for 2 min, and the reaction was carried out for 30 cycles. The PCR reaction system is as follows:

[0052] reaction system Volume (μL) 2xPrimer star Mix 25 forward primer 1 reverse primer 1 template DNA 1 wxya 2 o 22

[0053] 2. The PCR amplification product of the optimized Spirulina platensis CPD photorepair enzyme gene and the prokaryotic expression vector pET28 were respectively digested with Nde I and Xho I at 37°C for 2 hours, and recovered with 1...

Embodiment 3

[0062] Example 3 Purification and protein detection of Spirulina platensis CPD photorepair enzyme

[0063] 1. Inoculate the recombinant strain Rosetta (DE3) / pET28 / phr in 5 mL of LB liquid medium containing kanamycin, and cultivate overnight at 37°C with shaking. The next day, take 5 mL of the bacterial liquid and insert it into 500 mL of the same medium to continue culturing for ~4h (OD 600 After about 0.8), IPTG with a final concentration of 1 mM was added, cultured with shaking at 16° C. for 20 h, centrifuged at 8000 rpm for 5 min, and the cells were collected.

[0064] 2. Ni agarose affinity column affinity chromatography: the metal chelator Ni agarose is loaded into the chromatography column, and equilibrated with 1×Ni column binding buffer (25mM Tris, 500mM NaCl, 10% Glycerol, pH 8.0). Apply the supernatant to the column. Usually eluted with 300mM imidazole to collect the target protein.

[0065] 3. Superdex 200 gel size exclusion chromatography: equilibrate the Superd...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses spirulina platensis CPD (cyclobutane pyrimidine dimer) photolyase and an application thereof. The CPD photolyase has a polypeptide sequence represented by SEQ ID NO:2 or a polypeptide sequence which has CPD photolyase activity and is formed by replacing and / or losing and / or adding 1-10 amino acid residues in the polypeptide sequence represented by SEQ ID NO:2; and polynucleotide used for encoding the spirulina platensis CPD photolyase can have a nucleotide sequence represented by SEQ ID NO:1 or a nucleotide sequence which has higher than 90% of homology with the nucleotide sequence represented by SEQ ID NO:1 and can encode active protein of photolyase. According to the spirulina platensis CPD photolyase and the application thereof, a spirulina platensis CPD photolyase gene applicable to prokaryotic expression is optimized and artificially synthesized for the first time and is successfully cloned to an expression vector, a large amount of spirulina platensis CPD photolyase is acquired, spirulina platensis CPD photolyase can initiatively repair skin diseases caused by ultraviolet light when applied to related fields such as cosmetics, biological medicine and the like, and the spirulina platensis CPD photolyase has huge social benefits and economic values as well as great significance.

Description

technical field [0001] The present invention relates in particular to Spirulina platensis ( Spirulina platensis ), the CPD photorepair enzyme in ), its optimized coding gene, and the DNA damage repair activity of CPD photorepair enzyme in Spirulina platensis, involving the field of biology. Background technique [0002] For every organism, the accuracy and completeness of the genome is an important basis for its own survival and the normal execution of body functions. Each cell needs to withstand 50,000 to 500,000 times of DNA molecular damage every day due to genotoxic substances from the internal and external environment of the organism, various errors in the DNA replication process, and instability caused by the inherent biochemical properties of DNA itself. [0003] Ultraviolet rays are the most important environmental DNA damage agents. Although the ozone layer absorbs the most dangerous part of the sun's ultraviolet rays (ultraviolet C), the remaining ultraviolet ra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12N1/21A61K8/66A61Q17/04C12R1/01
CPCC12N9/88C12Y401/99003
Inventor 李旭沈辉王虹
Owner ANHUI BIOYEARNING BIO ENG