Efficient method for in-vitro evolution of serine hydroxymethyltransferase

A technology of serine hydroxymethyl and in vitro evolution, applied in the direction of transferase, introduction of foreign genetic material using vectors, recombinant DNA technology, etc., can solve the problems of only point mutation, sequence homology, low mutation rate, etc., and reach the site Multiple, simple operation, high frequency effect

Inactive Publication Date: 2014-09-03
HEFEI INSTITUTES OF PHYSICAL SCIENCE - CHINESE ACAD OF SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although there are many strategies for building a library, there are also obvious shortcomings and deficiencies. Although error-prone PCR is simple and easy to implement, it is a non-preferred amino acid substitution, with a low mutation rate and only point mutations; the method of mutagenic strains is often the whole organism or Plasmids are mutated, and can only be point mutations; the advantage of DNA recombination is that it requires the use of several parental genes, can create chimeras, merge useful mutations and discard harmful mutations, but requires sequence homology, which is often difficult to meet
The method of staggered extension is similar to DNA rearrangement, without fragment purification, which is simpler, but still requires sequence homology, and PCR operation must be specifically optimized

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Efficient method for in-vitro evolution of serine hydroxymethyltransferase
  • Efficient method for in-vitro evolution of serine hydroxymethyltransferase
  • Efficient method for in-vitro evolution of serine hydroxymethyltransferase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Start with Escherichia coli str.K-12substr.MG1655, and follow the steps below:

[0036] 1. Cultivate Escherichia coli in the following 50ml medium (g / L): peptone 10, yeast extract 5, sodium chloride 10, pH 7.2, and shake overnight at 37°C. The culture broth was collected, filtered with suction and dried with filter paper, and the genomic DNA was extracted with the kit and stored at -20°C. The serine hydroxymethyltransferase gene was used as the target gene, and the genomic DNA was used as the template. Taq DNA polymerase was used for PCR amplification and purification. The target fragment was 1254 bp in length. Design primers as follows:

[0037] Primer-F5': CGCGGATCCATGTTAAAGCGTG

[0038] Primer-R5': GGCAAGCTTTTATGCGTAAACC

[0039] 2. After the purified PCR product is digested with BamHI / HindIII double enzymes, it is separated and purified by conventional agarose gel electrophoresis. The recovered product is placed in a sterile 96-well plate, 20μl per well, frozen at -20°C f...

Embodiment 2

[0044] Start with the Bacillus subtilis (ACCC10075) strain, and follow the steps below:

[0045] 1. Cultivate Bacillus subtilis in the following 50ml medium (g / L): peptone 10, beef extract 3, sodium chloride 5, pH 7.2, 37°C shaker overnight. The culture broth was collected, filtered with suction and dried with filter paper, and the genomic DNA was extracted with the kit and stored at -20°C. Taking serine hydroxymethyltransferase gene as the target gene, using genomic DNA as template, PCR amplification and purification with TaqDNA polymerase, the target fragment length is 1248bp. Design primers as follows:

[0046] Primer-F5': CGCGGATCCATGA AACATTTACC

[0047] Primer-R5': GGCCTCGAGTTAATAATCTAATTC

[0048] 2. After the purified PCR product is digested with BamHI / XhoI double enzyme, conventional agarose gel electrophoresis is separated, purified and recovered, and the recovered product is placed in a sterile 96-well plate with about 20μl per well. After freezing at -20°C for 30 minutes...

Embodiment 3

[0053] Start with Flavobacterium columnare ATCC49512 and follow the steps below:

[0054] 1. Cultivate Flavobacterium in the following 50mL medium (g / L): glycerol 10, peptone 10, yeast extract 1.5, sodium chloride 3, K 2 HPO 4 .12H 2 O4.5MgSO 4 .7H 2 O, natural pH, 37°C shaker overnight. The culture broth was collected, filtered with suction and dried with filter paper, and the genomic DNA was extracted with the kit and stored at -20°C. Taking serine hydroxymethyltransferase gene as the target gene, using genomic DNA as template, PCR amplification and purification with Taq DNA polymerase, the target fragment length is 1275bp. Design primers as follows:

[0055] Primer-F5': ATAGGATCCATGTTACG CGACG

[0056] Primer-R5': GGCCTCGAGTTAAAAAACGAAC

[0057] 2. After the purified PCR product is digested with BamHI / XhoI double enzymes, conventional agarose gel electrophoresis is used to separate, purify and recover. The recovered product is placed in a sterile 96-well plate, about 25μl per wel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an efficient method for in-vitro evolution of serine hydroxymethyltransferase. The method comprises the following steps: performing PCR amplification on serine hydroxymethyltransferase genes of multiple resources, performing in-vitro low-energy ion injection on the serine hydroxymethyltransferase genes of multiple resources so as to establish a carrier, transforming a recipient bacterium, screening high-activity serine hydroxymethyltransferase strains and sequencing. The method has the beneficial effects that a low-energy ion radiation technique is adopted, low-energy ions directly act on the serine hydroxymethyltransferase genes of different resources so as to cause in-vitro radiation damage and modification on the serine hydroxymethyltransferase genes, the serine hydroxymethyltransferase genes are further connected with the carrier, the recipient bacterium is transformed, after in-vivo remediation and mutation, a mutant gene library is expressed and screened so as to obtain a serine hydroxymethyltransferase gene, and the in-vitro evolution is accomplished. The method can also be applied to in-vitro evolution of other enzyme molecules.

Description

Technical field [0001] The invention relates to a method for in vitro evolution of high-efficiency serine hydroxymethyltransferase, which belongs to the technical field of directed evolution of microbial enzyme genes and molecular modification technology. Background technique [0002] In vitro evolution refers to artificially creating special evolutionary conditions, simulating the natural evolutionary mechanism, randomly mutating genes in vitro, and finally obtaining certain properties expected in advance through certain screening or selection methods from one or more artificial mutant enzyme libraries The dominant mutant enzyme. In vitro evolution is a process of polymer evolution completed in a test tube, which provides a powerful means for changing the substrate specificity and catalytic activity of enzymes. It does not need to understand the relationship between the spatial structure and function of the protein. It only needs to construct a mutation library through multiple...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N9/10
Inventor赵根海郑之明王鹏王丽刘会贡国鸿吴跃进
OwnerHEFEI INSTITUTES OF PHYSICAL SCIENCE - CHINESE ACAD OF SCI