A Phaffia strain that efficiently overexpresses endogenous astaxanthin synthase gene

A technology of astaxanthin synthase and Phaffia yeast, applied in the biological field, can solve the problems of high price and increased demand for natural astaxanthin, and achieve the effect of high conversion efficiency

Inactive Publication Date: 2018-05-01
CHINA AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the source of astaxanthin on the market is mainly chemical synthesis, which is not only expensive, but also significantly different from natural astaxanthin in terms of structure, function, application and safety, so the demand for natural astaxanthin is increasing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Phaffia strain that efficiently overexpresses endogenous astaxanthin synthase gene
  • A Phaffia strain that efficiently overexpresses endogenous astaxanthin synthase gene
  • A Phaffia strain that efficiently overexpresses endogenous astaxanthin synthase gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0087] Example 1 Preparation of Phaffia cDNA

[0088] 1.1 Extraction of Phaffia total RNA

[0089] (1) Take an appropriate amount of Phaffia rhodozyma MK19 cells cultured to mid-logarithmic phase [disclosed in Chinese patent CN101717731A], grind with liquid nitrogen, add 1ml Trizol reagent (Invitrogen), shake vigorously for 5 minutes, and incubate at room temperature for 5 minutes ;

[0090] (2) Add 0.2ml chloroform, shake vigorously for 15-30 seconds, and incubate at room temperature for 3 minutes;

[0091] (3) 4°C, 12000rpm centrifuge for 15 minutes, the sample will be divided into three layers, transfer the colorless water phase of the upper layer to a new tube, and then proceed to the next step;

[0092] (4) Add one volume of isopropanol, mix by inverting, leave at room temperature for 10 minutes, centrifuge at 12000rpm at 4°C for 10 minutes, and discard the supernatant;

[0093] (5) Add 1ml of 75% ethanol to wash the precipitate, centrifuge at 7500rpm for 5 minutes at ...

Embodiment 2

[0108] Example 2 Acquisition of the Phaffia astaxanthin synthase gene crtS containing ribosome binding site and construction of the gene expression plasmid

[0109] 2.1 Primer design

[0110] According to the sequence of the crtS gene in GenBank (GenBank accession number is DQ002006), the synthetic cloning primers were designed as follows:

[0111] CRTSCPF: 5'—AATG CCATGG CCACCTACTTTCTCCATATG—3'

[0112] CRTSCPR: 5'-AA CTGCAG GACGACGTAGAAGTCATAGC—3'

[0113] NcoI and PstI restriction sites were designed at both ends of the cloning primer (see the italicized and underlined part in the above sequence)

[0114] 2.2 PCR amplification of the Phaffia astaxanthin synthase gene crtS containing ribosome binding site

[0115] CRTSCPF and CRTSCPR were used as primers, and the Phaffia cDNA obtained above was used as a template to amplify the cDNA fragment of crtS. The PCR reaction system was as follows:

[0116]

[0117] The reaction conditions are: 94°C for 3 minutes; 30 cycle...

Embodiment 3

[0124] Example 3 Overexpression of astaxanthin synthase in Phaffia MK19 promotes the increase of astaxanthin production

[0125] 3.1 Preparation of Phaffia MK19 electroporation competent cells and their electroporation transformation

[0126] 1) Inoculate the Phaffia seeds cultivated overnight in YPD medium into 100ml YPD medium at an inoculum size of 0.5%, cultivate to OD at 21°C and 200rpm 600 value is 1;

[0127] 2) Collect the cells by centrifugation at 8000 rpm at 4°C for 8 minutes, resuspend the cells with 13ml of 50mM potassium phosphate buffer (containing 25mM dithiothreitol) with a pH value of 7.0, and incubate at 21°C for 15 minutes;

[0128] 3) The cells were washed twice with 13ml of STM buffer, and finally resuspended in 0.8ml of STM buffer;

[0129] (STM buffer: 270mM sucrose, 10mM Tris HCl, pH7.5, 1mM MgCl 2 )

[0130] 4) Mix 4 μl (5 μg / ul) of plasmid DNA with 80 μl of the above-mentioned resuspended cells, place on ice for 15 minutes, and then transfer to a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a phaffia rhodozyma strain obtained by efficiently an over-expressing endogenous astaxanthin synthetase gene. The invention provides a phaffia rhodozyma genetic engineering strain capable of producing astaxanthin with high yield, obtained by over-expressing an endogenous astaxanthin synthetase gene. A phaffia rhodozyma genetic engineering strain (MK19-pGBKT7crtS) capable of producing astaxanthin with high yield is obtained by over-expressing the astaxanthin synthetase gene crtS by virtue of free plasmids and the strain is named CSR19. An endogenous ribosome bind site sequence (Rbs. sequence for short) exists in front of the crtS gene expressed by the strain. By virtue of fermentation cultivation and in comparison with a receptor strain MK19, the astaxanthin yield of the engineering strain is increased by 33.5%, and the engineering strain is good in stability, and thus, the phaffia rhodozyma strain has a good application prospect in the feed industry.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a strain of Phaffia yeast overexpressing an endogenous astaxanthin synthase gene with high efficiency and its application. Background technique [0002] Astaxanthin (chemical name: 3,3'-dihydroxy-4,4'-diketo-β-carotene), the molecular formula is C 40 h 52 o 4 , the molecular weight is 596.86. It is a lutein carotenoid that widely exists in nature. Some algae, bacteria, fungi and plankton can synthesize astaxanthin by themselves, while other higher organisms such as crustaceans, fish and birds pass through the food chain Ingest astaxanthin, and then store it in the body, making the appearance red and increasing the commercial value. [0003] Astaxanthin is the highest-level product of carotenoid synthesis, so in nature, astaxanthin has the strongest antioxidant activity, can effectively remove oxygen free radicals in cells, and can inhibit tumorigenesis and enhance immune function...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/81C12N1/19C12P23/00C12R1/645
CPCC12N9/0077C12P23/00
Inventor李颖迟爽何彦锋苏倩楼慧强李季伦
OwnerCHINA AGRI UNIV