Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of trichoderma brevicompactum transformant in improvement of trichodermin yield

A technology of Trichoderma umbilicus and transformed strains, which is applied in the field of microbial technology and biological control, can solve problems such as long distance, and achieve the effects of increasing concentration and improving reliability.

Inactive Publication Date: 2015-01-21
CHINA JILIANG UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In order to improve the development value and market competitiveness of Trichoderma, many researchers have adopted methods such as physical mutagenesis and induction to increase the yield of Trichoderma, but at this stage, the level of Trichoderma production is far from the industrialization process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of trichoderma brevicompactum transformant in improvement of trichodermin yield

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 (Preparation of plasmid containing hygromycin B resistance gene fragment)

[0020] Proceed as follows:

[0021] (1) The host bacteria of pSilent-1 and pCAMBIA0380 plasmids were cultured in LB medium at 37 °C and 180 r / min. After 12 h, the SanPrep column plasmid DNA mini-extraction kit was used to extract pSilent-1 respectively. and pCAMBIA0380 plasmid.

[0022] (2) Use restriction endonucleases Bst X I and Xma I enzyme, carry out double enzyme digestion to pSilent-1, pCAMBIA0380 plasmids respectively, the digestion products are separated by 1% agarose gel electrophoresis, cut out the target band, and use the SanPrep column DNA gel recovery kit to recover the target band .

[0023] (3) The hygromycin B resistance gene fragment (Hygr) on the pSilent-Si plasmid was ligated to the BstX I / Xma I restriction site of the pCAMBIA0380 plasmid using T4 DNA ligase, and the plasmid at this time was named pCAMBIA0380-H .

Embodiment 2

[0024] Example 2 (Agrobacterium-mediated transformation)

[0025] Proceed as follows:

[0026] (1) The pCAMBIA0380-H plasmid was transformed into Agrobacterium AGL-1 competent cells, in YEB medium (medium composition: sucrose 5 g / L, yeast extract 1 g / L, peptone 10 g / L, Magnesium sulfate 0.5 g / L) was cultured at 28°C for two days and then picked a single colony and extracted the plasmid, using the hygromycin B resistance gene verification primer H-F / H-R (H-F: GAAGAGGTAAACCCGAAACG, H-R: GGCA AACTGTGA TGGACGAC) for bacterial liquid PCR, The positive transformants were further screened, and the verified Agrobacterium-positive clone was named AP03H.

[0027] (2) The positive clone AP03H was co-cultured with the spore suspension of Trichoderma umbilicus 0248, and the hygromycin B resistance gene was transformed and integrated into the 0248 strain. A positive transformant (named AZ1) was obtained by screening on the potato dextrose agar plate;

[0028] (3) Use liquid medium contai...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the fields of microbial technologies and biological prevention and control, and particularly relates to an application of a trichoderma brevicompactum 0248 transformant with hygromycin B resistance in improvement of trichodermin yield. Through obtaining the trichoderma brevicompactum transformant containing a hygromycin B resistance gene, and adding hygromycin B to a liquid fermentation culture medium, the concentration of trichodermin in the fermentation liquid is improved. A reliable method is provided for improving the fermentation unit of trichodermin; and an application of the trichoderma brevicompactum transformant with hygromycin B resistance in improvement of the trichodermin yield is provided.

Description

[0001] technical field [0002] The present invention relates to the field of microbial technology and biological control, in particular to Trichoderma umbilicus with hygromycin B resistance ( Trichoderma brevicompactum ) Application of 0248 transformant in increasing the yield of trichoderma. Background technique [0003] Trichodermin, a kind of trichothecenes, has different degrees of inhibition on mycelial growth and spore germination of 9 common phytopathogenic fungi. Botrytis cinerea and other fungal diseases have good biocontrol effects, so they are considered to be antifungal compounds with broad biocontrol application prospects. Trichoderma is mainly produced by the Trichoderma fungus Trichoderma umbilicus ( T. brevicompactum ) produced by fermentation. In order to improve the development value and market competitiveness of trichoderma, many researchers use methods such as physical mutagenesis and induction to increase the production of trichoderma. The research...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P17/18C12N1/15C12R1/885
Inventor 申屠旭萍袁小枫俞晓平刘卫平汤谷
Owner CHINA JILIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More