NASBA-ELISA (nucleic acid sequence-based amplification-enzyme-linked immuno sorbent assay) detection primer, probe and kit for type II grass carp reovirus

A technique for detecting reoviruses and primers, which is applied in the directions of DNA/RNA fragments, recombinant DNA technology, and microbial measurement/inspection. High detection efficiency and high accuracy

Inactive Publication Date: 2015-03-04
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, there is no report on the establishment of a NASBA detection method for grass carp reovirus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • NASBA-ELISA (nucleic acid sequence-based amplification-enzyme-linked immuno sorbent assay) detection primer, probe and kit for type II grass carp reovirus
  • NASBA-ELISA (nucleic acid sequence-based amplification-enzyme-linked immuno sorbent assay) detection primer, probe and kit for type II grass carp reovirus
  • NASBA-ELISA (nucleic acid sequence-based amplification-enzyme-linked immuno sorbent assay) detection primer, probe and kit for type II grass carp reovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Design and synthesis of specific primers and probes

[0039] The S6 sequences of seven strains of GCRV-GD108, 106, 918, HeNan988, HeNan794, HZ08 and 109 were obtained from NCBI and compared; a pair of amplification primers and corresponding capture probes and detection probes were designed in the conserved region.

[0040] S6-F: 5'- GATGCAAGGTCGCATATGAG CAGACGGGTCACCGTATTGTTACA-3' (SEQ ID NO.1), the underlined part is complementary to the detection probe;

[0041] S6-R: 5'- AATTCTAATACGACTCACTAAAGGGAGAAGG GAACTCATCAGTAAAGTCGGA-3' (SEQ ID NO.2), the underlined part is the T7 promoter sequence.

[0042] Type II GCRV S6 gene-specific capture probe: S6-CP: 5'BIO-TCAGCAGGTGCCGTTAATTTGT-3' (SEQ ID NO.3);

[0043] Type II GCRV S6 gene-specific detection probe S6-DP: 5'-TGATGCAAGGTCGCATATGAG-DIG3' (SEQ ID NO.4).

Embodiment 2

[0044] Exploration and Optimization of Primer Concentration, Enzyme Concentration and Ion Concentration in Example 2 NASBA Method

[0045] (1)K + Concentration optimization

[0046] In various literatures, K + Concentrations are 10mM, 20mM, 42mM, 70mM, 120mM; literature shows that the concentration above 100mM has little effect on the results; K in the basic system + The concentration is 25mM; the KCl concentration is respectively set to 25mM, 50mM, and 75mM for NASBA amplification. The results of 50mM and 75mM are similar, both of which are brighter than the band amplified by 25mM, so it is determined to use 50mM KCl in the future system.

[0047] (2) Optimization of the dosage of RNaseH

[0048] In different literatures, the amount of RNaseH used in each 20ul reaction system ranged from 0.1U, 0.2U to 0.8U; DMSO or sorbitol was added to the reaction system using less RNaseH to stimulate the endogenous RNaseH activity of AMV. However, too little RNaseH is difficult to abs...

Embodiment 3

[0053] The establishment of embodiment 3NASBA-ELISA reaction system and reaction program

[0054] 1. Extraction of viral RNA

[0055] ①Take 200ul virus sample, add 1ml Trizol, shake vigorously for 15s, and place at room temperature for 5min;

[0056] ② Add 200ul chloroform, shake vigorously for 15s, and centrifuge at 12000rpm at 4°C for 15min;

[0057] ③Take the supernatant, add 650ul isopropanol, and precipitate at -20°C for 10min;

[0058] ④ Centrifuge at 12000rpm at 4°C for 15min, remove the supernatant;

[0059] ⑤ Add 75% ethanol prepared with 1ml DEPC water to wash the precipitate, and centrifuge at 8000rpm at 4°C for 5min;

[0060] ⑥ Gently remove the supernatant, suck off the residual liquid with a pipette tip, and dry the precipitate at room temperature for 10 minutes;

[0061] ⑦ Add 24ul of DEPC water to dissolve the precipitate, divide 5ul into 8 tubes and store at -80°C for later use; at the same time, extract RNA from healthy grass carp tissue as a control.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses an NASBA-ELISA (nucleic acid sequence-based amplification-enzyme-linked immuno sorbent assay) detection primer, a probe and a kit for type II grass carp reovirus. Nucleotide sequences of the primer and the probe are as shown in SEQ ID NO.1-4. The kit contains the primer, the probe, an NASBA amplification buffer solution, an enzyme mixed liquor, an amplification product detection reagent, a negative control and a positive control. The kit for the type II grass carp reovirus has the advantages that a detection time period is short, and detection efficiency is high; virus detection specificity is high, and accuracy is high; virus quantitative analysis can be realized while virus qualitative analysis is realized; detection sensitivity is higher than that of common PCR (polymerase chain reaction); operation is easy, and popularization is easy; and repeatability of experimental results is good.

Description

technical field [0001] The invention belongs to the field of virus molecular biology, and relates to an in vitro detection method of grass carp reovirus, in particular to a type II grass carp reovirus NASBA-ELISA detection kit. Background technique [0002] Grass carp reovirus (GCRV) belongs to the genus Aquatic Reovirus, a new member of Reoviridae, and the first fish virus isolated from mainland China. The virus mainly causes haemorrhagic disease in freshwater cultured grass carp species in China, Vietnam, Myanmar and other Asian countries, and the mortality rate can be as high as 60%. The virus is widespread, harmful, high in mortality, and has a long onset season, which seriously threatens fishery production. Grass carp reovirus has a double-layer capsid, the average diameter of the virion is 60 nm-70 nm, icosahedral symmetry, no envelope, and the genome consists of 11 segmented double-stranded RNAs. More than 30 isolates have been reported, including GCRV854, GCRV861, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/6804C12Q1/70C12Q2531/143C12Q2563/131
Inventor曾伟伟王庆王英英梁虹茹吴淑勤宋新建李莹莹石存斌
OwnerPEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI