Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pig epidemic diarrhea virus S gene RT-LAMP detection kit and detection method

An RT-LAMP, porcine epidemic diarrhea technology, applied in the field of porcine epidemic diarrhea virus S gene RT-LAMP detection kits, can solve the problems of volatile aerosol polluted environment, primer error amplification, low specificity and the like, Achieve high sensitivity, high specificity, and obvious color rendering effects

Inactive Publication Date: 2015-03-04
GUANGDONG WENS DAHUANONG BIOTECH +1
View PDF6 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Chinese patent application CN103276103A discloses a kind of RT-LAMP nucleic acid test strip kit and application for detecting porcine epidemic diarrhea virus. After the reaction, the test strip is inserted into the reaction solution to detect the product, which is the same as adding SYBR Green I or Green Finder dyes are the same, need to open the cover, especially easy to form volatile aerosols and pollute the environment, causing false positives
Chinese patent application CN102021249A discloses a method for detecting porcine epidemic diarrhea by reverse transcription-loop-mediated isothermal amplification. It uses the N gene as the primer target gene, designs 3 pairs of primers, and detects it through a two-step method, that is, the first step It is to extract RNA and reverse transcribe it into cDNA. The second step is to add cDNA to the LAMP reaction system for isothermal reaction, and finally observe the experimental results by dye color change method. Since the N gene is a conserved sequence, so is PEDV. Primers have high specificity for a single virus, but for similar viruses, there are cases where the specificity is not high, that is, in practical applications, the primer may be erroneously amplified. gene primer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pig epidemic diarrhea virus S gene RT-LAMP detection kit and detection method
  • Pig epidemic diarrhea virus S gene RT-LAMP detection kit and detection method
  • Pig epidemic diarrhea virus S gene RT-LAMP detection kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] A porcine epidemic diarrhea virus S gene RT-LAMP detection kit, which comprises buffer, Bst DNA polymerase, dNTPs, betaine, MgSO 4 , AMV reverse transcriptase, calcein, MnCl 2 , inhibitors and the following 6 primers:

[0077] F3 GGCATCTGCATGAGGTCCAGACGTAAAGAGCTTCCTGAA

[0078] B3 GTTACCCGAACCTGTAGGCT

[0079] F1C GCTATCGCATGGTGAAGG

[0080]F2 CAAGGATGGTGCCATGAACAAAGCTTTGGATTCATTATTAGCAC

[0081] B1C CAAGTTGAAATTCGCCTGG

[0082] B2 ACCAACTACTCTTGGTAGTCGTG;

[0083] Among them, buffer, Bst DNA polymerase, dNTPs, betaine, MgSO 4 , AMV reverse transcriptase, calcein, MnCl 2 , inhibitors and 6 primers were: 10×Bst buffer 2.5μL, Bst DNA polymerase 8U, 10mmol / L dNTPs 3.5μL, 1mol / L betaine 3μL, 100mmol / L MgSO 4 0.5μL, 5U / μL AMV reverse transcriptase 0.5μL, 250μmol / L calcein 3μL, 25mmol / L MnCl 2 0.5μL, 40U / μL Inhibitor 1.5μL, 40μmol / L F1C 0.5μL, 40μmol / L B1C 0.5μL, 20μmol / L B30.25μL, 20μmol / L F30.25μL, 20μmol / L F20.85μL, 20μmol / L B20 .85 μL.

Embodiment 2

[0085] 1) Propagation and harvesting steps of PEDV: subculture Vero cell PEDV, after it grows into a monolayer, the PEDV freeze-dried virus is diluted with DMEM and inoculated on Vero cells, after culturing until obvious lesions appear, scrape the cells to harvest the virus liquid;

[0086] 2) Extraction steps of viral RNA: TIANamp viral genome DNA / RNA extraction kit was used to extract PEDV viral RNA from the above-mentioned virus liquid, and the specific steps were as follows:

[0087] a) Add 20 μL proteinase K to a clean 1.5mL centrifuge tube with a pipette;

[0088] b) Add 200 μL of plasma / serum / lymph fluid equilibrated to room temperature into the centrifuge tube;

[0089] c) Add 200 μL of Carrier RNA working solution, cap the tube, and vortex for 15 seconds to mix. In order to ensure sufficient lysis, the sample and Carrier RNA working solution need to be thoroughly mixed; the Carrier RNA working solution is prepared according to the following formula:

[0090] n×0.22m...

Embodiment 3

[0115] On the basis of Example 2, the optimization of the RT-LAMP reaction conditions is also included; the specific steps are: increase the temperature in order of 56°C, 58°C, 60°C, 62°C, 64°C, and 66°C, and after repeated Determine the optimal reaction temperature; configure 1mol / L Betaine, 250umol / L Calcein, 5mmol / L MnCl 2 , 100mmol / L MgSO 4 , optimize the RT-LAMP reaction conditions together with AMV and Bst DNA polymerase; configure the working concentration of 6 primers (10mmol / mL) to optimize the primer concentration ratio; the reaction time is 30min, 45min, 60min and 75min in sequence Increased determination of optimal reaction time. For optimization results see Figure 1-4 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pig epidemic diarrhea virus S gene RT-LAMP detection kit and a detection method. The pig epidemic diarrhea virus S gene RT-LAMP detection kit comprises a buffer agent, Bst DNA polymerase, dNTPs, glycine betaine, MgSO4, AMV reverse transcriptase, calcein, MnC12, an inhibitor and six primers as shown in sequences SEQ ID NO:1 to SEQ ID NO:6. By adopting the pig epidemic diarrhea virus S gene RT-LAMP detection kit disclosed by the invention, the experiment steps are greatly simplified, and the accuracy rate is increased. By adopting the non-diagnosis RT-LAMP detection method of a pig epidemic diarrhea virus S gene, a method which needs no special instrument and is relatively simple, convenient, rapid and specific in detecting pig epidemic diarrhea viruses is provided for detecting PEDV in outdoor and local laboratories.

Description

technical field [0001] The invention relates to the technical field of biological detection methods, in particular to a porcine epidemic diarrhea virus S gene RT-LAMP detection kit and detection method. Background technique [0002] In recent years, piglet diarrhea presents a trend of multiple occurrences, which seriously restricts the healthy development of the pig breeding industry due to its characteristics of rapid transmission, low cure rate, and high mortality. Diarrhea virus infection is one of the most important causes of diarrhea in piglets. Many viruses can cause diarrhea in piglets, such as norovirus, boca virus, astrovirus, etc., but the most common and most harmful are porcine transmissible gastroenteritis virus and porcine epidemic diarrhea virus, and the latter is the most important. [0003] Porcine epidemic diarrhea (Porcine epidemic diarrhea, PED) is an acute, contact, and highly contagious digestive tract disease caused by porcine epidemic diarrhea virus ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/6844C12Q1/70C12Q1/701C12Q2531/119C12Q2563/107
Inventor 刘好朋贺东生陈瑞爱胡京京李冰张显浩
Owner GUANGDONG WENS DAHUANONG BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com