Field test kit for resistance to dmi fungicides of peach brown rot fungus
A detection kit and technology for brown rot fungus, which is applied in the determination/inspection of microorganisms, recombinant DNA technology, methods based on microorganisms, etc., can solve the problems of high technical requirements, heavy workload, and limited number of determination samples, etc. To achieve the effect of accurate detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] Ring-mediated isothermal amplification of ring-specific primers MoF / MoB / MoFIP / MoBIP of peach brown rot strain (M.fructicola):
[0068] The peach brown rot strains were collected from South Carolina in the United States, and 22 DMI-resistant strains were obtained by indoor routine single-spore isolation. 19 DMI-sensitive strains were isolated from Hubei, Yunnan, and Gansu in China. According to Luo et al. (document), primers UpCYP-1F: AGAGCTACCACCCACGAGGAA and UpCYP-1R: GACCGCTGCGAAATCTCTTGA were designed according to the upstream region of DMI fungicide target gene MfCYP51 to amplify DMI-resistant and sensitive strains respectively. The upstream region contained a 65bp Mona fragment insertion, but none of the DMI-susceptible strains contained this insertion.
[0069] According to the 65bp sequence and its upstream and downstream sequences, circularization-specific primers were designed using the online website of LAMP primer design (http: / / primerexplorer.jp / e / ):
[007...
Embodiment 2
[0080] Mycelium of peach brown rot strain (M.fructicola) was directly amplified with circularization-specific primers MoF / MoB / MoFIP / MoBIP:
[0081] The peach brown rot strain collected from South Carolina, USA in 2011, picked its mycelium and used it directly for drug resistance detection: pick a small amount of mycelium and put it in a PCR centrifuge tube, add 10uL Lyse Go, 100℃ water After heating for 5 minutes, let it cool down at room temperature. Take 5.9uL of liquid as a template, and use circularization-specific primers MoF / MoB / MoFIP / MoBIP to amplify it. Using the kit formula in the present invention, the 25uL reaction system contains ①2.5ul10×Thermopol Buffer buffer solution②3.0uL dNTPs (Mixture) (10mmol / L)③5.0uL MgCl 2 (25mmol / L) ④External primer: 0.3uL each of MoF and MoB (10umol / L) ⑤Inner primer: 3.5uL each of MoFIP and MoBIP (10umol / L) ⑥BstDNA polymerase (8U / uL) 1uL ⑦5.9uL lysate (about 5ngDNA) for the template. Amplification conditions: 61°C for 75min, 85°C for...
Embodiment 3
[0083] Example 3: Carrying out dyeing reaction on circularized amplification products
[0084] SYBRGreen I is a dye with a green excitation wavelength that binds to the minor groove region of all dsDNA double helices. In the free state, SYBRGreenⅠ emits weak fluorescence, but once combined with double-stranded DNA, the fluorescence is greatly enhanced. Using this feature, if a large number of double strands are generated during amplification, after adding the dye, it will produce green fluorescence that can be clearly distinguished by the naked eye, and if no amplification product is generated, there will be no color change after adding the dye, and it will appear reddish brown . see results image 3 , the resistant strains can produce green fluorescence after amplification and staining, while the sensitive strains are reddish brown after amplification and staining.
[0085]The detection principle of the kit of the present invention: the Lyse Go reagent of Thermo Scientific...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 