Unlock instant, AI-driven research and patent intelligence for your innovation.

Field test kit for resistance to dmi fungicides of peach brown rot fungus

A detection kit and technology for brown rot fungus, which is applied in the determination/inspection of microorganisms, recombinant DNA technology, methods based on microorganisms, etc., can solve the problems of high technical requirements, heavy workload, and limited number of determination samples, etc. To achieve the effect of accurate detection

Active Publication Date: 2016-09-28
HUAZHONG AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The traditional method for determining the susceptibility of mycelium to pharmaceuticals usually takes several weeks, with heavy workload, limited sample quantity, strict aseptic operation, and it is difficult to detect the existence of drug-resistant strains at an early stage
The detection method based on PCR technology requires expensive instruments and requires high technical requirements for operators, so it is not suitable for promotion in the field or in agricultural departments such as cities and counties.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Field test kit for resistance to dmi fungicides of peach brown rot fungus
  • Field test kit for resistance to dmi fungicides of peach brown rot fungus
  • Field test kit for resistance to dmi fungicides of peach brown rot fungus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Ring-mediated isothermal amplification of ring-specific primers MoF / MoB / MoFIP / MoBIP of peach brown rot strain (M.fructicola):

[0068] The peach brown rot strains were collected from South Carolina in the United States, and 22 DMI-resistant strains were obtained by indoor routine single-spore isolation. 19 DMI-sensitive strains were isolated from Hubei, Yunnan, and Gansu in China. According to Luo et al. (document), primers UpCYP-1F: AGAGCTACCACCCACGAGGAA and UpCYP-1R: GACCGCTGCGAAATCTCTTGA were designed according to the upstream region of DMI fungicide target gene MfCYP51 to amplify DMI-resistant and sensitive strains respectively. The upstream region contained a 65bp Mona fragment insertion, but none of the DMI-susceptible strains contained this insertion.

[0069] According to the 65bp sequence and its upstream and downstream sequences, circularization-specific primers were designed using the online website of LAMP primer design (http: / / primerexplorer.jp / e / ):

[007...

Embodiment 2

[0080] Mycelium of peach brown rot strain (M.fructicola) was directly amplified with circularization-specific primers MoF / MoB / MoFIP / MoBIP:

[0081] The peach brown rot strain collected from South Carolina, USA in 2011, picked its mycelium and used it directly for drug resistance detection: pick a small amount of mycelium and put it in a PCR centrifuge tube, add 10uL Lyse Go, 100℃ water After heating for 5 minutes, let it cool down at room temperature. Take 5.9uL of liquid as a template, and use circularization-specific primers MoF / MoB / MoFIP / MoBIP to amplify it. Using the kit formula in the present invention, the 25uL reaction system contains ①2.5ul10×Thermopol Buffer buffer solution②3.0uL dNTPs (Mixture) (10mmol / L)③5.0uL MgCl 2 (25mmol / L) ④External primer: 0.3uL each of MoF and MoB (10umol / L) ⑤Inner primer: 3.5uL each of MoFIP and MoBIP (10umol / L) ⑥BstDNA polymerase (8U / uL) 1uL ⑦5.9uL lysate (about 5ngDNA) for the template. Amplification conditions: 61°C for 75min, 85°C for...

Embodiment 3

[0083] Example 3: Carrying out dyeing reaction on circularized amplification products

[0084] SYBRGreen I is a dye with a green excitation wavelength that binds to the minor groove region of all dsDNA double helices. In the free state, SYBRGreenⅠ emits weak fluorescence, but once combined with double-stranded DNA, the fluorescence is greatly enhanced. Using this feature, if a large number of double strands are generated during amplification, after adding the dye, it will produce green fluorescence that can be clearly distinguished by the naked eye, and if no amplification product is generated, there will be no color change after adding the dye, and it will appear reddish brown . see results image 3 , the resistant strains can produce green fluorescence after amplification and staining, while the sensitive strains are reddish brown after amplification and staining.

[0085]The detection principle of the kit of the present invention: the Lyse Go reagent of Thermo Scientific...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer for field rapid detection of the resistance of peach brown rot fungus to a DMI bactericide. The primer comprises the following two pairs of primers: outer primers and inner primers with the sequences of MoF:TTTAAGGTACGAACACGAATC, MoB:TCGATGTAGGTGATGGAAG, MoFIP:TGTAAAAAGTATCTCTTCAATACCTTTCAAATCTAAACTACGGTA and MoBIP:GAGCAGAGTATCCCATTTAAATGTGTGAGGACTCGTTGTT respectively. The invention also provides a kit prepared by using the primers, and an application of the kit in the detection of whether a peach brown rot fungus strain has resistance to the DMI bactericide or not. The kit can effectively predicate that the bactericide can effectively prevent and treat peach brown rot pathogens or not before the bactericide is sprayed in order to prevent the control failure caused by continuous spraying of pathogens having resistance.

Description

technical field [0001] The invention relates to the technical field of detection of drug resistance of plant pathogenic bacteria, in particular to a field detection kit for the resistance of brown rot fungi to DMI fungicides. Background technique [0002] Peach brown rot is an important disease that seriously endangers peach production caused by the ascomycete Monilinia spp. In addition to harming ordinary peaches, the disease also harms stone fruit trees such as nectarines, cherries, apricots, and plums. Some species even harm pome fruit trees such as apples and pears. Brown rot spreads all over the world, among which the United States, some countries in Asia and Europe are the most serious, and can cause serious economic losses before and after harvesting. [0003] The use of fungicides is currently the main means of controlling the disease. Sterol demethylase inhibitors (DMIs) fungicides are commonly used in production to control peach brown rot. After more than 20 year...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11C12R1/645
CPCC12Q1/6844C12Q1/6895C12Q2531/119
Inventor 罗朝喜陈淑宁林杨阴伟晓
Owner HUAZHONG AGRI UNIV