Method for establishing humanized rat drug evaluation animal model

A human and construct technology, applied in the direction of using vectors to introduce foreign genetic material, recombinant DNA technology, animal husbandry, etc., can solve problems such as differences in expression profiles, differences in gene regulation, and limited use

Inactive Publication Date: 2015-05-06
INST OF LAB ANIMAL SCI CHINESE ACAD OF MEDICAL SCI
View PDF0 Cites 64 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the patents of these humanized mice are in the hands of some foreign drug companies, which limits the use of medical research institutions in my country
In addition, mice are not CFDA-approved drug evaluation animals, and there are still large differences with humans in terms of expression profile differences and gene regulation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for establishing humanized rat drug evaluation animal model
  • Method for establishing humanized rat drug evaluation animal model
  • Method for establishing humanized rat drug evaluation animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Production of Transgenic Rats Expressing Abcb1 Bacterial Artificial Chromosomes

[0024] The longest spliced ​​cDNA (4718bp) of the human Abcb1 gene and its upstream and downstream regulatory sequences (upstream length is 66kbp, ATG downstream length is 87kbp) were cloned into the bacterial artificial chromosome BAC, and the BAC expression vector expressing Abcb1 was completed. After the constructed carrier was extracted by phenol-chloroform method, the concentration was adjusted to 1-2ng / μl, BAC was injected into fertilized eggs of SD rats by microinjection technique, and SD rats were used as pseudopregnant recipient rats , to prepare transgenic rats. A total of 15 F0 generation rats were obtained, and the genomic DNA of the born rats was extracted. In order to detect its integrity, three pairs of PCR primers were used to detect the integrity of the upper, middle and lower reaches of the inserted BAC, respectively: Abcb1-BAC-F1: 5'-CACCAGTAAGAGCGTTGA-3' Dow...

Embodiment 2

[0025] Example 2: Production of Abcb1 knockout rats

[0026] Construction of gRNA plasmid for Abcb1 gene targeting: a target GGAGACAAATACACAAGATT was designed for the Abcb1 gene, and a pair of oligonucleotide chains (TAGGAGACAAATACACAAGATT and AAACAATCTTGTGTATTTGTCT; used to prepare sgRNA were synthesized; the synthesized oligonucleotide was annealed (97 After 6 mins at ℃ and naturally lowered to room temperature), connect into the pUC57-sgRNA expression vector recovered by Bsa I enzyme digestion to construct the sgRNA expression vector. Verify whether the connected fragment is correct by sequencing, select the correct clone, and prepare for use after expanding the culture Later in vitro transcription.

[0027] In vitro transcription: the Cas9 expression plasmid was digested with Age I and linearized, extracted and purified with phenol chloroform, dissolved in nuclease-free water as a template, and used for in vitro transcription. The synthesis of Cas9 mRNA was completed by T...

Embodiment 3

[0029] Embodiment 3: the cultivation of humanized Abcb1 rat

[0030] rAbcb1 gene knockout homozygous rats can be obtained by crossing the obtained rAbcb1 gene knockout rats, and BAC positive and rAbcb1 gene knockout rats can be obtained by crossing hAbcb1-BAC positive rats with rAbcb1 gene knockout rats In addition to the heterozygous rats, by crossing this strain of rats with rAbcb1 gene knockout homozygous rats, hAbcb1-BAC positive and rAbcb1 gene knockout homozygous rats can be obtained. This kind of rat lacks the expression of its own Abcb1 gene at the gene level, and at the same time, it also carries the human Abcbl gene obtained through BAC technology.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for establishing a humanized rat drug evaluation animal model. According to the method, a multidrug resistance gene 1 (Abcb1)-knocked-out genetically engineered rat is obtained through a microinjection method by virtue of a CRISPR / Cas9 gene knockout technology and 153kb bacterial artificial chromosome (BAC) fragments containing a humanized Abcb1 promoter and cDNA is simultaneously inoculated into the rat genome through the microinjection method by virtue of a large fragment transgenic technology to obtain a transgenic rat capable of stably expressing human Abcb1 and the genetically engineered rat and the transgenic rat are hybridized to establish the humanized rat drug evaluation animal model. RT-PCR analysis shows that Abcb1 expression profiles of humanized Abcb1 rat are significantly different from those of the rat endogenous Abcb1. The method has the beneficial effects that the humanized rat capable of expressing human Abcb1 is obtained and the rat is used for expressing human Abcb1 genes and has closer expression profiles to those of human so that the model can be well used for the efficacy evaluation of newly developed drugs.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for establishing a humanized rat drug evaluation animal model. Background technique [0002] It takes an average of 10,000 to 25,000 individual compounds to produce an innovative drug, costing as much as $1-1.7 billion. In addition to the non-significant pharmacodynamics, nearly 50% of drug development suspensions are attributed to drug toxicity, and there have been events of withdrawal of drugs from the market due to drug toxicity to patients. Not only causing huge economic losses, but also causing loss of life. Therefore, the international pharmaceutical industry has been researching an accurate, reliable, fast and sensitive method system for toxicity screening of new chemicals in the early stages of new drug development, so as to discover and eliminate potentially toxic chemicals or chemical structures in time, and shorten the time of new drug development as much as poss...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85A01K67/027
Inventor张连峰马婧
OwnerINST OF LAB ANIMAL SCI CHINESE ACAD OF MEDICAL SCI