Recombinant dimerized antithrombin III-fc fusion protein and its high-efficiency expression system in mammalian cells
A fusion protein and cell technology, which is applied in the treatment of various coagulation-related diseases, and can solve the problems of low yield, poor stability, and extended half-life of AT derivatives, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0083] Example 1. Construction of a gene encoding hAT-L-vFcγ fusion protein
[0084] Human AT gene was purchased from Thermo-Fisher Company. The target gene was amplified by polymerase chain reaction (PCR). In order to facilitate cloning, the oligonucleotide sequence TCAGATCCGCTAGCCGCCCACCATGGTCTCCCAGGCCCTCAGGCTC introduced into the restriction enzyme endonuclease site NheI was used as a 5' primer; the BamHI restriction endonuclease site was introduced into The dot oligonucleotide sequence GTCGAGGATCCGGGAAATGGGGCTCGCAGGAGGAC was used as the 3' primer. The human AT gene sequence was verified by DNA sequencing.
[0085] Flexible Peptide Linker and Human IgG Fc Region Fc γ 2 variant vFc γ2 (Pro331Ser mutation), Fc γ 4 variant vFc γ4 (Ser228Pro and Leu235Ala mutations), Fc γ 1 variant vFc γ1 (Leu234Val, Leu235Ala, and Pro331SSer mutations) fusion genes were obtained by artificial synthesis, and the 5' and 3' ends of the synthesized fragments each had a restriction enzyme e...
Embodiment 2
[0087] Example 2. Expression of fusion proteins in transfected cell lines
[0088] Transfection of recombinant expression vector plasmids into mammalian host cell lines to express hAT-L-vFc γ fusion protein. For stable high-level expression, the preferred host cell line is DHFR enzyme-deficient CHO-cells (US Patent No. 4,818,679). A preferred method of transfection is electroporation, although other methods including calcium phosphate co-sedimentation, lipofection, and protoplast fusion can also be used. In electroporation, use the Gene Pulser Electroporator (Bio-Rad Laboratories, Hercules, CA) set to 250V electric field and 960μFd capacitance, 2~5×10 7 Add 10 μg of plasmid DNA linearized with PvuI to each cell. Two days after transfection, the medium was changed to growth medium containing 0.4 mg / mL G418. Transfectants were screened for resistance to the selective drug using an anti-human IgG Fc ELISA assay. ELISA for anti-AT analysis can also be used to quantify the ex...
Embodiment 3
[0090] Example 3. Production of fusion proteins
[0091] The high-yield cell line preferably obtained in Example 2 is first subjected to serum-free acclimation culture in a petri dish, and then transferred to a shake flask for suspension acclimatization culture. After the cells have adapted to these culture conditions, they are then cultured in 300 ml shake flasks with fed supplementation. The above-mentioned CHO-derived cell lines were cultured in 100 ml shake flasks for 16 days, and the cumulative production of recombinant fusion proteins expressed by them was 2 g / L ( image 3 ). Between day 6 and day 12 of cell culture, the number of viable cells was at most about 7×10 6 individual / mL. In order to obtain more hAT-L-vFc recombinant protein, 2000 ml shake flask culture can also be selected.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More