Application of high-positive-charge fluorescent protein in glycosaminoglycans (GAGs) and analogues of GAGs

Abstract

The invention relates to the application of high-positive-charge green fluorescent protein (GFP) in the research of glycosaminoglycans (GAGs), wherein the amino acid sequence of the high-positive-charge fluorescent protein is as shown in SEQ ID No. 1. According to the application of the high-positive-charge GFP, the high-positive-charge GFP is taken as a fluorescent probe with biocompatibility, high sensitivity and high selectivity for the first time and is applied to the visualization of the GAGs on the surface of a living cell, the high selectivity quantitative analysis of the GAGs in serum, the pollution analysis of excessively sulfated chondroitin sulfate in heparin, etc. Therefore, the defects that the traditional cationic dye is poor in biocompatibility, low in selectivity, low in sensitivity and the like in the detection of the GAGs can be overcome; the high-positive-charge GFP has important application value and can be widely applied to basic and application study, clinical diagnosis, detection of medicines and food, and the like which are related to the GAGs.

Description

technical field

[0001] The invention relates to the application of highly positively charged green fluorescent protein in the research of glycosaminoglycans, belonging to the technical field of biochemistry. Background technique

[0002] Glycosaminoglycans (GAGs), also known as mucopolysaccharides, are linear polyanionic polysaccharides composed of repeating disaccharide units. Mainly including hyaluronic acid (Hyaluronic Acid, HA), heparin / heparan sulfate (Hep / HS), chondroitin sulfate / dermatan sulfate (Chondroitin Sulfate / Dermatan Sulfate, CS / DS), keratan sulfate (Keratan Sulfate, KS). Except that the disaccharide unit of keratan sulfate is composed of neutral D-galactose and N-acetylglucosamine, the disaccharide units of other GAGs are composed of hexuronic acid (D-glucuronic acid / L-ido Uronic acid) and hexosamine (N-acetylglucosamine / N-acetylgalactosamine). Among them, the structure of HA is relatively simple, and the disaccharide units composed of D-glucuronic acid an...

Examples

Embodiment 1

[0028] Embodiment 1, the acquisition of ScGFP gene

[0029] Obtain the amino acid sequence of ScGFP (+36) through literature reports [7], and convert the obtained amino acid sequence into the corresponding base sequence, and optimize the codon of the corresponding base to make it easier to be used in E. coli Express. The corresponding DNA sequence was fully synthesized by Sangon Bioengineering Company.

Embodiment 2

[0030] Embodiment 2, expression and purification of ScGFP (+36) protein

[0031] Using the ScGFP gene obtained in Example 1 as a template, PCR amplification was performed. Primers are as follows:

[0032] Forward primer ScGFP-F:

[0033] (g CATATG ATGGGTCACCATCATCATCACG)

[0034] Reverse primer ScGFP-R:

[0035] (g CTCGAG TTTGTAGCGTTCGTCACGACCGTG)

[0036]The underlined forward primer is the restriction endonuclease Nde I site, and the reverse primer is underlined the restriction endonuclease Xho I site. The PCR product was double-digested, and the double-digested PCR product was ligated with the pET-22b vector that had also been double-digested, and a positive recombinant plasmid (pET22b-ScGFP) was screened. The gene sequencing results showed that the ScGFP gene was inserted between the Nde I and Xho I restriction sites of pET-22b, and the insertion direction was correct.

[0037] pET22b-ScGFP was transformed into Escherichia coli strain BL21(DE3) (purchased from No...

Embodiment 3

[0038] Example 3. Different concentrations of glycosaminoglycans inhibit the effect of graphene oxide on quenching scGFP fluorescence

[0039] Add 0.01-0.5μg of ScGFP to 10mM Tris-HCl 100mM NaCl (pH7.0) solution, then add heparin (Hep), chondroitin sulfate A (CS-A), dermatan sulfate (DS), hyaluronic acid (HA) to a final concentration of 0-1 μg / ml and a total volume of 190 μl. After standing at room temperature for 10 minutes, add 10 μl of graphene oxide, mix well, and leave at room temperature for 10 minutes. Fluorescence intensity measurement was performed with a fluorescence spectrophotometer (F-4600, Hitachi). The results show that when the concentration of glycosaminoglycan is 0-1 μg / ml, there is a linear relationship between the fluorescence intensity of the reaction system and the concentration of glycosaminoglycan (such as figure 2 ).

[0040] Add 0.01-0.5 μg of ScGFP to serum diluted 10 times with 10 mM Tris-HCl 100 mM NaCl (pH 7.0), and then add different amounts o...

technical field

[0001] The invention relates to the application of highly positively charged green fluorescent protein in the research of glycosaminoglycans, belonging to the technical field of biochemistry. Background technique

[0002] Glycosaminoglycans (GAGs), also known as mucopolysaccharides, are linear polyanionic polysaccharides composed of repeating disaccharide units. Mainly including hyaluronic acid (Hyaluronic Acid, HA), heparin / heparan sulfate (Hep / HS), chondroitin sulfate / dermatan sulfate (Chondroitin Sulfate / Dermatan Sulfate, CS / DS), keratan sulfate (Keratan Sulfate, KS). Except that the disaccharide unit of keratan sulfate is composed of neutral D-galactose and N-acetylglucosamine, the disaccharide units of other GAGs are composed of hexuronic acid (D-glucuronic acid / L-ido Uronic acid) and hexosamine (N-acetylglucosamine / N-acetylgalactosamine). Among them, the structure of HA is relatively simple, and the disaccharide units composed of D-glucuronic acid an...

Examples

Embodiment 1

[0028] Embodiment 1, the acquisition of ScGFP gene

[0029] Obtain the amino acid sequence of ScGFP (+36) through literature reports [7], and convert the obtained amino acid sequence into the corresponding base sequence, and optimize the codon of the corresponding base to make it easier to be used in E. coli Express. The corresponding DNA sequence was fully synthesized by Sangon Bioengineering Company.

Embodiment 2

[0030] Embodiment 2, expression and purification of ScGFP (+36) protein

[0031] Using the ScGFP gene obtained in Example 1 as a template, PCR amplification was performed. Primers are as follows:

[0032] Forward primer ScGFP-F:

[0033] (g CATATG ATGGGTCACCATCATCATCACG)

[0034] Reverse primer ScGFP-R:

[0035] (g CTCGAG TTTGTAGCGTTCGTCACGACCGTG)

[0036]The underlined forward primer is the restriction endonuclease Nde I site, and the reverse primer is underlined the restriction endonuclease Xho I site. The PCR product was double-digested, and the double-digested PCR product was ligated with the pET-22b vector that had also been double-digested, and a positive recombinant plasmid (pET22b-ScGFP) was screened. The gene sequencing results showed that the ScGFP gene was inserted between the Nde I and Xho I restriction sites of pET-22b, and the insertion direction was correct.

[0037] pET22b-ScGFP was transformed into Escherichia coli strain BL21(DE3) (purchased from No...

Embodiment 3

[0038] Example 3. Different concentrations of glycosaminoglycans inhibit the effect of graphene oxide on quenching scGFP fluorescence

[0039] Add 0.01-0.5μg of ScGFP to 10mM Tris-HCl 100mM NaCl (pH7.0) solution, then add heparin (Hep), chondroitin sulfate A (CS-A), dermatan sulfate (DS), hyaluronic acid (HA) to a final concentration of 0-1 μg / ml and a total volume of 190 μl. After standing at room temperature for 10 minutes, add 10 μl of graphene oxide, mix well, and leave at room temperature for 10 minutes. Fluorescence intensity measurement was performed with a fluorescence spectrophotometer (F-4600, Hitachi). The results show that when the concentration of glycosaminoglycan is 0-1 μg / ml, there is a linear relationship between the fluorescence intensity of the reaction system and the concentration of glycosaminoglycan (such as figure 2 ).

[0040] Add 0.01-0.5 μg of ScGFP to serum diluted 10 times with 10 mM Tris-HCl 100 mM NaCl (pH 7.0), and then add different amounts o...

Images