Supercharge Your Innovation With Domain-Expert AI Agents!

Retroactive gene and application of dsRNA (double-stranded ribonucleic acid) of Retroactive gene in pest control

A technology of genes and gene fragments, applied in the biological field, can solve the problems of polluting the agricultural ecological environment, natural enemies and higher animals and other non-target organisms

Inactive Publication Date: 2015-07-22
SHANXI UNIV
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional chemical control methods not only pollute the agricultural ecological environment, but also cause serious damage to non-target organisms such as natural enemies and higher animals. Therefore, the research and development of new technologies for green pest control has become an important topic for agricultural science and technology workers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Retroactive gene and application of dsRNA (double-stranded ribonucleic acid) of Retroactive gene in pest control
  • Retroactive gene and application of dsRNA (double-stranded ribonucleic acid) of Retroactive gene in pest control
  • Retroactive gene and application of dsRNA (double-stranded ribonucleic acid) of Retroactive gene in pest control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] Embodiment 1: migratory locust Rtv gene full-length cDNA sequence and encoded amino acid

[0016] 1. Search for Rtv genes of migratory locusts

[0017] The Rtv gene was searched from the transcriptome database of migratory locusts using bioinformatics methods, and the homology analysis was performed using Blastx of the NCBI database, and a full-length sequence of Rtv gene of migratory locusts was confirmed and screened.

[0018] 2. Verification of the full-length cDNA of the migratory locust Rtv gene

[0019] Based on the above-mentioned full-length sequence of the migratory locust Rtv gene, a primer was designed for full-length cloning using primer premier5.0 software. Among them, the upstream primer CGTATGTCACAGTTACCATGAAAATC (SEQ ID NO: 3) and the downstream primer TTATCAGTTCACAAGCCAGTCTCC (SEQ NO: 4). The primers were synthesized by Shanghai Yingwei Jieji Biological Co., Ltd.

[0020] Select 5th-instar migratory locust nymphs with healthy growth and uniform size,...

Embodiment 2

[0023] Embodiment 2: Migratory locust Rtv gene fragment dsRNA synthesis

[0024] 1. Design of dsRNA primers for migratory locust Rtv gene fragment

[0025] Based on the full-length sequence of migratory locust SEQ ID NO: 1, a pair of primers for synthesizing dsRNA were designed using primer premier5.0 software (upstream and downstream primers both contain T7 promoter, shown in italic sequence), wherein the sequence of the upstream primer is The sequence of taatacgactcactatagggGCCAACGGAGCGTATTCTTA (SEQ ID NO: 5) and the downstream primer is taatacgactcactatagggATTCGTTGACGAGTTGCACA (SEQ ID NO: 6). The primers were synthesized by Shanghai Yingwei Jieji Biological Co., Ltd.

[0026] 2. Specific dsRNA synthesis of migratory locust Rtv gene fragment

[0027] The frozen and diluted plasmid in the full-length cDNA verification process of Example 1 was used as a template after thawing and dilution, and PCR amplification was performed with the upstream and downstream primers containin...

Embodiment 3

[0028] Embodiment 3: Lethal experiment of migratory locust Rtv gene fragment dsRNA

[0029] 1. Specific dsRNA Injection

[0030] A total of 34 5th-instar and 2-day-old nymphs with healthy growth, uniform size, and half male and half male were selected. 2.5 μl (6.25 μg) of dsRNA were gently injected into the nymph body cavity using a microsyringe. At the same time, 30 nymphs were injected with the same amount of dsGFP as a control. Both groups of nymphs were reared in a 30°C constant temperature biochemical incubator (light:dark time=14h:10h, temperature 30±2°C, humidity 60%), and supplied with sufficient fresh wheat and wheat bran.

[0031] 2. dsRNA effect detection

[0032] After dsGFP and dsRtv were injected into the locust body cavity for 24 hours, 9 nymphs (3 biological replicates, 3 worms per replicate) were collected to extract RNA according to the TaKaRa Trizol kit, and then reverse transcribed into first-strand cDNA. Real-time PCR was used to detect the mRNA expres...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Relative molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a Retroactive gene and an application of dsRNA (double-stranded ribonucleic acid) of the Retroactive gene in pest control. Specifically, a Retroactive gene segment is acquired through searching in a migratory locust transcriptome database and is subjected to full-length cloning and sequencing to obtain a full-length cDNA (complementary deoxyribonucleic acid) sequence of the Retroactive gene, a nucleotide sequence and a coded amino acid sequence are SEQ ID NO:1 and SEQ ID NO:2 respectively, a segment with the nucleotide sequence of SEQ ID NO:7 is further designed to synthesize the corresponding dsRNA, the dsRNA is injected into a migratory locust body cavity, the migratory locust cannot exuviate old skin and is dead finally, and the fatality rate is up to 91.2%. The dsRNA has high fatality rate, thereby providing a new molecular target locus for pest control and having significance on effective pest control.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of migratory locust Retroactive gene and its dsRNA in pest control. Background technique [0002] Migratory locusts are an important agricultural pest in the history of our country, and locust outbreaks pose a great threat to agricultural production. At present, its control mainly relies on chemical insecticides. Traditional chemical control methods not only pollute the agricultural ecological environment, but also cause serious damage to non-target organisms such as natural enemies and higher animals. Therefore, research and development of new technologies for green pest control has become an important topic for agricultural scientists. [0003] RNA interference (RNAi) is a specific post-transcriptional gene silencing phenomenon caused by double-stranded RNA molecules. RNAi technology has been a frontier hotspot in the field of biological sciences since it won the N...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K14/435C12N15/113C12N15/10A01N57/16A01P7/04
Inventor 于荣荣张建珍张敏丁国伟马恩波
Owner SHANXI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More