Nanometer antibody for resisting B cell growth stimulating factor and use thereof
A technology of nano-antibody and growth stimulation, applied in the direction of anti-receptor/cell surface antigen/cell surface determinant immunoglobulin, antibody, biochemical equipment and method, etc., can solve the problems that have not yet been reported by nano-antibody, and achieve inhibition Effects on B cell proliferation or survival
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1: Expression of BAFF extracellular segment protein
[0054] 1. Fishing for sBAFF gene: Take normal human venous blood, and extract peripheral blood mononuclear cells (PBMC) according to conventional methods. The extraction of RNA was carried out according to the instruction of Invitorgen Company. 3ug RNA was reverse-transcribed to prepare a cDNA template, which was used as a template to amplify the BAFF gene.
[0055] The primer sequences are:
[0056] 5'CGGGAATTCCTGGTGCCACGCGGTGCCGTCAGGGTCCAGAAG3' (SEQ ID No. 3)
[0057] 5'CCCAAGCTTTCACAGCAGTTTCAATGC3' (SEQ ID No. 4)
[0058] PCR reaction conditions:
[0059]
[0060] 2. Construction of expression vectors: PCR amplification products were separated and recovered by agarose gel electrophoresis, digested with EcoRI (BioLab Company), HindIII (BioLab Company), and treated with the same enzyme as vector pET-30a (Sigma) by 3 :1 end ratio for cohesive end ligation. Ligation product by CaCl 2 The transformati...
Embodiment 2
[0067] Embodiment 2: Construction of anti-BAFF specific nanobody library
[0068] 1. Immune the alpaca, and analyze the production of nanobodies by enzyme immunoassay.
[0069] A total of 1.5 mg of antigen was injected subcutaneously at multiple points on the neck and back of the alpaca, and Freund's adjuvant was added, and the immunization was divided into 4 times. The absorption of the injected mass was followed up to confirm the correct immunization. Serum antibody titers were determined one month after the first immunization ( figure 2 ); after immunization, the interval between each immunization was halved, and the titer was determined. Use Protein G column and affinity chromatography to separate the serum one week after the fourth immunization, and detect the heavy chain antibody production and antibody titer by ELISA. After the fourth immunization, the titer of alpaca immune serum can reach 1: 10000. ( image 3 ).
[0070] 2. Isolation of Alpaca Peripheral Blood L...
Embodiment 3
[0100] Embodiment 3: the acquisition of anti-BAFF nanobody
[0101] 1. Screening of anti-BAFF-specific nanobodies
[0102] Anti-BAFF nanobodies were screened from the phage library by biotinylated BAFF and streptavidin magnetic beads. The biotin-labeled BAFF antigen was mixed with the phage antibody library in proportion, and reacted overnight at 4°C. Add the antigen-phage antibody complex into the EP tube containing streptavidin magnetic beads, and roll and rotate for 0.5h to fully combine the magnetic beads with the biotin-labeled antigen-phage antibody complex. After each washing with PBST (0.05% T20) and PBS for 10 times, the phages were eluted with TEA and allowed to stand at room temperature for 10 minutes. 1M Tris-HCl neutralized TEA, kept on ice. Infect the bacteriophage in semi-logarithmic growth TG1, take an appropriate amount of bacterial solution and spread it on AMP / LB plate, culture at 32°C, measure the titer of the eluent, and superinfect the remaining bacter...
PUM
| Property | Measurement | Unit |
|---|---|---|
| purity | aaaaa | aaaaa |
| affinity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 