Nanometer antibody for resisting B cell growth stimulating factor and use thereof

A technology of nano-antibody and growth stimulation, applied in the direction of anti-receptor/cell surface antigen/cell surface determinant immunoglobulin, antibody, biochemical equipment and method, etc., can solve the problems that have not yet been reported by nano-antibody, and achieve inhibition Effects on B cell proliferation or survival

Active Publication Date: 2015-07-29
SHENZHEN PREGENE BIOPHARMA CO LTD
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] No nanobodies against BAFF have been reported so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nanometer antibody for resisting B cell growth stimulating factor and use thereof
  • Nanometer antibody for resisting B cell growth stimulating factor and use thereof
  • Nanometer antibody for resisting B cell growth stimulating factor and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1: Expression of BAFF extracellular segment protein

[0054] 1. Fishing for sBAFF gene: Take normal human venous blood, and extract peripheral blood mononuclear cells (PBMC) according to conventional methods. The extraction of RNA was carried out according to the instruction of Invitorgen Company. 3ug RNA was reverse-transcribed to prepare a cDNA template, which was used as a template to amplify the BAFF gene.

[0055] The primer sequences are:

[0056] 5'CGGGAATTCCTGGTGCCACGCGGTGCCGTCAGGGTCCAGAAG3' (SEQ ID No. 3)

[0057] 5'CCCAAGCTTTCACAGCAGTTTCAATGC3' (SEQ ID No. 4)

[0058] PCR reaction conditions:

[0059]

[0060] 2. Construction of expression vectors: PCR amplification products were separated and recovered by agarose gel electrophoresis, digested with EcoRI (BioLab Company), HindIII (BioLab Company), and treated with the same enzyme as vector pET-30a (Sigma) by 3 :1 end ratio for cohesive end ligation. Ligation product by CaCl 2 The transformati...

Embodiment 2

[0067] Embodiment 2: Construction of anti-BAFF specific nanobody library

[0068] 1. Immune the alpaca, and analyze the production of nanobodies by enzyme immunoassay.

[0069] A total of 1.5 mg of antigen was injected subcutaneously at multiple points on the neck and back of the alpaca, and Freund's adjuvant was added, and the immunization was divided into 4 times. The absorption of the injected mass was followed up to confirm the correct immunization. Serum antibody titers were determined one month after the first immunization ( figure 2 ); after immunization, the interval between each immunization was halved, and the titer was determined. Use Protein G column and affinity chromatography to separate the serum one week after the fourth immunization, and detect the heavy chain antibody production and antibody titer by ELISA. After the fourth immunization, the titer of alpaca immune serum can reach 1: 10000. ( image 3 ).

[0070] 2. Isolation of Alpaca Peripheral Blood L...

Embodiment 3

[0100] Embodiment 3: the acquisition of anti-BAFF nanobody

[0101] 1. Screening of anti-BAFF-specific nanobodies

[0102] Anti-BAFF nanobodies were screened from the phage library by biotinylated BAFF and streptavidin magnetic beads. The biotin-labeled BAFF antigen was mixed with the phage antibody library in proportion, and reacted overnight at 4°C. Add the antigen-phage antibody complex into the EP tube containing streptavidin magnetic beads, and roll and rotate for 0.5h to fully combine the magnetic beads with the biotin-labeled antigen-phage antibody complex. After each washing with PBST (0.05% T20) and PBS for 10 times, the phages were eluted with TEA and allowed to stand at room temperature for 10 minutes. 1M Tris-HCl neutralized TEA, kept on ice. Infect the bacteriophage in semi-logarithmic growth TG1, take an appropriate amount of bacterial solution and spread it on AMP / LB plate, culture at 32°C, measure the titer of the eluent, and superinfect the remaining bacter...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
affinityaaaaaaaaaa
Login to view more

Abstract

The invention discloses a nanometer antibody for resisting a B cell growth stimulating factor and a use thereof and belongs to the field of biotechnology. The nanometer antibody for resisting a B cell growth stimulating factor has an amino acid sequence shown in the formula of SEQ ID NO. 1 in the sequence table. Through screening of multiple nanometer antibodies with high activity and a latent neutralising capacity, the nanometer antibody G3 for resisting BAFF is obtained. The nanometer antibody can specifically bond with a human BAFF antigen, adjust biological activity of the BAFF antigen and related ligands, and effectively inhibit bonding of the BAFF antigen and its receptors and production of corresponding signal cascade effects. The nanometer antibody for resisting BAFF can block combination of BAFF and its three receptors, can substantially inhibit B cell proliferation or viability and can be used for detection and /or treatment on a plurality of BAFF expression abnormity-related diseases.

Description

technical field [0001] The invention relates to an anti-B cell growth stimulating factor nanobody and its use, belonging to the field of biotechnology. Background technique [0002] Lymphoma is a malignant tumor that originates in lymph nodes or lymphoid tissue. It has massive proliferation of lymphocytes and (or) histiocytes. It accounts for the eighth place among common malignant tumors in my country, and the trend of getting younger is obvious. In recent years, the incidence rate has increased from 2 to 4 / 100,000 rose to 6.91 / 100,000, and increased at a rate of 5% per year, with about 50,000 new patients and more than 20,000 deaths each year. It is generally believed that Hodgkin's lymphoma is mainly derived from B cells, and most non-Hodgkin's lymphomas are also derived from B cells. Therefore, treating lymphoma by eliminating B cells has become a new treatment plan. [0003] Clinical studies have found that malignant B cells such as lymphoma can synthesize and secrete ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/28C12N15/13C12N15/63G01N33/68A61K39/395A61P35/00A61P35/02A61P37/02A61P29/00
Inventor 张伟京李胜华孙剑武文任光达
Owner SHENZHEN PREGENE BIOPHARMA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap