Unlock instant, AI-driven research and patent intelligence for your innovation.

Method of degrading lignin of plants with engineering bacteria of saccharomyces cerevisiae

A technology of Saccharomyces cerevisiae and lignin, applied in the field of construction and application of microbial engineering bacteria, which can solve the problems of low enzyme production, long cycle of degrading lignin, slow growth of white rot fungi, etc., and achieve the effect of low nutritional requirements and rapid growth and reproduction

Inactive Publication Date: 2015-08-12
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The advantage of using white rot fungi to degrade plant lignin is that white rot fungi have a complete enzyme system for degrading lignin (manganese peroxidase, lignin peroxidase and laccase). The manganese peroxidase gene, lignin peroxidase gene and laccase gene contained in the fungus are only a single copy, and the yield of the expressed enzyme is small, and the growth of white rot fungi is slow, and the cycle of degrading lignin is long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of degrading lignin of plants with engineering bacteria of saccharomyces cerevisiae
  • Method of degrading lignin of plants with engineering bacteria of saccharomyces cerevisiae
  • Method of degrading lignin of plants with engineering bacteria of saccharomyces cerevisiae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0018] 1. Obtain the relevant originals required for the enzyme gene and the construction of the expression vector

[0019] (1) PCR amplification of the promoter sequence of phosphoglyceraldehyde dehydrogenation of Saccharomyces cerevisiae

[0020] The cell wall of Saccharomyces cerevisiae was cleaved with helicase, the genomic DNA of Saccharomyces cerevisiae was extracted, and the following primers were used: 5'TCGAGTTTATCATTATCAAT3' and 5'TCGAAACTAAGTTCTTGGTG3') for PCR amplification, and the PCR product was sequenced and analyzed with BLAST software provided by NCBI to prove that it was Saccharomyces cerevisiae Promoter sequence of the yeast glyceraldehyde triphosphate dehydrogenase gene.

[0021] (2) PCR amplification of the laccase gene of Bacillus subtilis

[0022] The cell wall of Bacillus subtilis was cleaved with helicase, the genomic DNA of Bacillus subtilis was extracted, and the upstream primer (5AA CCTAGG ATGACACTTGAAAAATTTGTGGATGC3') and downstream primer (5'A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method of degrading lignin of plants with engineering bacteria of brewing yeast and belongs to the biotechnology field. The method includes following steps: (I) cloning lignin peroxidase gene, manganese peroxidase gene and laccase gene from the microorganisms; (II) constructing a brewing yeast expression carrier containing the three gene expression frames; (III) converting the brewing yeast expression carrier into brewing yeast; and (IV) performing G418 resistance screening to obtain the engineering bacteria of brewing yeast containing the gene expression frames of the lignin peroxidase gene, the manganese peroxidase gene and the laccase gene; and (V) degrading the lignin of plants by means of reaction between the three engineering bacteria of brewing yeast and plant raw materials. The degradation effect of the engineering bacteria of brewing yeast on the lignin is stronger than that of a natural microorganism which naturally expresses and secretes manganese peroxidase, lignin peroxidase and laccase and is used for degrading the lignin of the plants.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to a method for constructing and applying microbial engineering bacteria. Specifically, it is a method for degrading lignin of plant raw materials by using microbial engineering bacteria. Background technique [0002] Manganese Peroxidase (MnP), Lignin Peroxidase (LiP) and Laccase have the function of degrading lignin together. [0003] Plant resources are constantly regenerated and are very rich. The basic components of plants are cellulose, hemicellulose and lignin. Among them, the most useful component in the manufacture of biogas and ethanol industry is cellulose, followed by hemicellulose. The former is composed of glucose while the latter is composed of pentose sugars. These sugars are converted into ethanol and biogas. However, the cellulose molecules are inlaid with lignin, and the inlaid cellulose cannot be hydrolyzed. Lignin is an amorphous, aromatic polymer containing oxyp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): D21C5/00C12N15/81C12N15/53C12N1/19C12R1/865
CPCC12N15/81C12N1/185C12R2001/865D21C5/005
Inventor 张爱联符仙杨穗珊张添元
Owner INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI