P53R175H specific nucleic acid aptamer and screening method and use thereof

A p53r175h, nucleic acid aptamer technology, applied in the field of biomedicine, to achieve the effect of slowing down the migration rate, small molecular weight, high affinity and specificity

Active Publication Date: 2015-10-21
UNIV OF SCI & TECH OF CHINA
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are no reports of specific RNA aptamers that can specifically target mutant proteins in the world

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • P53R175H specific nucleic acid aptamer and screening method and use thereof
  • P53R175H specific nucleic acid aptamer and screening method and use thereof
  • P53R175H specific nucleic acid aptamer and screening method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Embodiment 1, the screening of nucleic acid aptamer

[0068] 1. Design and synthesis of random nucleic acid library

[0069] Design and synthesize single-stranded DNA as shown below, including a random sequence of 25 nucleotides in the middle, which constitutes a nucleic acid sequence library

[0070] TAATACGACTCACTATAGCAATGGTACGGTACTTCC(N25)CAAAAGTGCACGCTACTTTG

[0071] 2. Protein coupled solid phase carrier

[0072] 2.1. Coupling p53R175H protein (Cat. No. AZ-026Abzyme, amino acid sequence shown in SEQ ID NO. 4) to NHS-activated magnetic beads (28-9940-09 GE Healthcare).

[0073] Put an appropriate amount of magnetic beads from the original tube into a new EP tube, place it on the magnetic stand, and remove the original storage solution;

[0074] Add 500 μl ice-cooled balance solution (1mM HCl (ice-cold)), mix well, and remove the balance solution;

[0075] Immediately after equilibration, add 10 μg of protein, in binding buffer (0.2M NaHCO 3 , 0.5M NaCl, pH 8.3)...

Embodiment 2

[0143] Embodiment 2, affinity screening method based on ELISA

[0144] Those skilled in the art will understand that the binding ability of the nucleic acid aptamer to the target protein can be detected by other methods than the ELISA method.

[0145] 1. T vector construction and blue-white screening

[0146] a. Configure the T carrier connection system according to the following system:

[0147]

[0148] b. Transforming the ligation product into competent cells;

[0149] c. On the ampicillin-resistant LB plate, coat 100ul IPTG and 200ul X-Gal in advance, and put it in a 37°C incubator to dry. Spread the competent cells cultured at low speed evenly on the plate, and incubate at 37°C for 12-16 hours;

[0150] d. Pick white clones the next day, culture the bacteria and send them for sequencing;

[0151] e. Extract plasmids from samples with successful sequencing, and use them as templates for in vitro transcription in the next step.

[0152] 2. In vitro transcription of ...

Embodiment 3

[0179] Example 3, the nucleic acid aptamer obtained by screening has no affinity for p53 wild-type protein

[0180] 1. p53 co-immunoprecipitation experiment

[0181] a. Place HEK293T cells on a 10cm cell culture plate, culture at 37°C for 12-18h under 5% CO2 environment, and use LipofectAmine 2000 system to transfect the sequences screened in Example 1 respectively when the cell density reaches 60-70% The nucleic acid aptamer (p53R175H-APT) shown in SEQ ID NO.1 and scramble (which is a random negative control sequence GCAATGGTACGGTACTTCCGCCTGGCTGGTCTTTGAACTCTTTTTCAAAAGTGCACGCTACTTTG) were continued to be cultured until 48 hours after transfection and subsequent experiments were started;

[0182] b. Cell cross-linking reaction: add methanol with a final concentration of 0.75% to the cell culture dish, and shake gently at room temperature for 10 minutes;

[0183] c. Add a glycine solution with a final concentration of 125 mM, and gently shake for 5 minutes at room temperature t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid aptamer specifically binding to a p53 mutant protein p53R175H, wherein the nucleic acid aptamer comprises a sequence shown in SEQ ID NO.1. The invention also discloses a derivative of the nucleic acid aptamer, a screening method of the nucleic acid aptamer and a use of the nucleic acid aptamer in treating tumor.

Description

technical field [0001] The present invention relates to the field of biomedicine, in particular to the screening and application of an RNA aptamer, in particular to the specific RNA aptamer screening method and application of a mutant protein. Background technique [0002] The p53 protein is a known important tumor suppressor protein. There are multiple functional domains in the p53 protein. In the core region of the p53 protein, there is a DNA binding domain at about 100-300 amino acids. This domain achieves DNA binding based on sequence-specific binding. This domain is considered to be the most important domain for p53 function, because subsequent studies have further confirmed that most tumors associated with p53 mutations are caused by nonsense mutations in this core domain of p53, and more than half of human tumors are associated with mutations in the p53 protein. With the development of sequencing technology, there are more than 10,000 p53 mutations in all known hum...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/115C12N15/10G01N33/68G01N33/574A61K31/7088A61P35/00
Inventor单革陈亮
OwnerUNIV OF SCI & TECH OF CHINA