Supercharge Your Innovation With Domain-Expert AI Agents!

Fluorescent quantitative PCR detection method of spring viraemia of carp virus

A carp spring viremia, fluorescence quantitative technology, applied in the direction of microbe-based methods, microbiological measurement/inspection, biochemical equipment and methods, etc., can solve the problems that affect the accuracy and sensitivity of detection, cannot be effectively detected, false Negative results and other issues, to achieve high sensitivity, efficient detection, and strong specificity

Active Publication Date: 2015-10-28
上海市水产研究所(上海市水产技术推广站)
View PDF6 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the amplification primers that these two kinds of methods adopt all are designed for virus G gene, yet because carp spring viremia virus is RNA virus, G protein is virus surface glycoprotein again, G gene mutation is very fast, gene The variation of the sequence seriously affects the accuracy and sensitivity of its detection, which can easily cause false negative results, lead to misjudgment, and eventually cause the further spread of the disease
For example, the 2014 Shanghai isolates SH140503 (Genebank registration number: KR012467) and SH140522 (Genebank registration number: KR012468) could not be effectively detected by the fluorescent quantitative PCR method for G

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative PCR detection method of spring viraemia of carp virus
  • Fluorescent quantitative PCR detection method of spring viraemia of carp virus
  • Fluorescent quantitative PCR detection method of spring viraemia of carp virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Taking cell samples infected by European and Asian strains of carp spring viremia virus with a long evolutionary distance as examples, TaqMan real-time fluorescent quantitative PCR method was used to detect carp spring viremia virus.

[0044] The above-mentioned design-specific primer sequences and fluorescent probe sequences:

[0045] Search the gene sequence of carp spring viremia virus in the GenBank database, use BioEdit 7.9 software for gene sequence comparison analysis, and analyze and compare the evolution rate of each gene by BEAST 1.8 software. The results show that, compared with the G gene, carp spring viremia virus The nucleoprotein N gene of viruses is more conserved. Therefore, according to the conserved region of the N gene, use Primer Express 3.0 software to design and screen specific primer sequences and fluorescent probe sequences, wherein the specific primer sequences include forward primers and reverse primers, and the fluorescent probes are TaqMan p...

Embodiment 2

[0056] Taking carp samples as an example, SYBR GREEN I fluorescent dye method was used to detect carp spring viremia virus.

[0057] Six carp samples to be tested were collected from a farm in Minhang, Shanghai. Anatomy showed that there were no obvious clinical symptoms of carp spring viremia, and whether they carried carp spring viremia virus was tested.

[0058] Get the mixed homogenate tissue of liver, spleen, kidney and brain of 30 mg carp to be tested, total RNA extraction and cDNA synthesis are the same as in Example 1, the specific primers and probe sequences used are the same as in Example 1, and the SYBR GREEN I fluorescent dye method only Specific primers are required, no fluorescent probes are required.

[0059] SYBR GREEN I real-time quantitative PCR reaction system and reaction procedures are the same as described in 4 of the technical scheme. 7500Fast fluorescent quantitative PCR instrument was used for the reaction, and the reaction condition was 95°C for 30 s...

Embodiment 3

[0062] The sensitivity of the fluorescent quantitative PCR detection method using the specific primers and probes for the N gene designed by the present invention and the primers and probes for the G gene in the carp spring viremia quarantine technical specification SN / T 1152-2011 Compare.

[0063] Take 20 healthy carp for artificial infection experiment. After 14 days of virus inoculation, different tissues of liver, spleen, kidney, brain, muscle and testis of infected carp were sampled respectively. Total RNA extraction and cDNA synthesis are the same as in Example 2. The N Gene-specific primers and probes are the same as in Example 1.

[0064] The primers and probes for the G gene used are as follows:

[0065] SVCV-GF: ATCATTCAAAGGATTGCATCAG;-

[0066] SVCV-GR: CATATGGCTCTAAATGAACAGAA;

[0067] SVCV-G-tag: FAM-TCCCCCTCAAAGTTGCGGATGG-TRAMA

[0068] The fluorescent probe was labeled with the fluorescent reporter group FAM at the 5' end of the fluorescent probe and the flu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
Login to View More

Abstract

The invention discloses a fluorescent quantitative PCR detection method of spring viraemia of carp virus, and belongs to the technical field of aquatic virus detection. According to the fluorescent quantitative PCR detection method of the spring viraemia of carp virus, a specific primer probe set used for detecting the spring viraemia of carp virus is arranged and composed of specific primer pairs aiming at the spring viraemia of carp virus and fluorescent probes. By means of the provided primers, good sensitivity and specificity for identifying the spring viraemia of carp virus are achieved. By means of the fluorescent quantitative PCR detection method of the spring viraemia of carp virus, hemorrhagic tissues infected by the spring viraemia of carp virus can be detected, asymptomatic fish carrying the spring viraemia of carp virus and cells infected by the spring viraemia of carp virus can be detected, and great application prospects for rapid detection and supervision of the epidemic disease on entry-exit aquatic animals are achieved.

Description

technical field [0001] The invention belongs to the field of aquatic virus detection, in particular to the rapid detection of fish carp spring viremia virus. Background technique [0002] Spring viraemia of carp (SVC) is an acute epidemic with hemorrhage as the main clinical symptom and highly contagious. The pathogen is Spring viraemia of carp virus (SVCV). ). Carp spring viremia virus can cause obvious symptoms in carps such as carp, koi, grass carp, silver carp, bighead carp, crucian carp, etc., but common carp is its main and most sensitive host, and people of all ages Carp can be infected. The virus often breaks out in spring when the water temperature is 8-20°C, especially 13-15°C, and it does not fall ill when the water temperature exceeds 22°C. The more suitable the water temperature and the poorer the health of the fish, the more likely it is to be infected. The diseased fish has systemic hemorrhage and severe ascites, acute onset, and high mortality rate. The mo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/6851C12Q1/686C12Q1/70C12Q1/701C12Q2531/113C12Q2545/113C12Q2561/101
Inventor 邵玲肖雨
Owner 上海市水产研究所(上海市水产技术推广站)
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More