Fluorescent quantitative PCR detection method of spring viraemia of carp virus
A carp spring viremia, fluorescence quantitative technology, applied in the direction of microbe-based methods, microbiological measurement/inspection, biochemical equipment and methods, etc., can solve the problems that affect the accuracy and sensitivity of detection, cannot be effectively detected, false Negative results and other issues, to achieve high sensitivity, efficient detection, and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Taking cell samples infected by European and Asian strains of carp spring viremia virus with a long evolutionary distance as examples, TaqMan real-time fluorescent quantitative PCR method was used to detect carp spring viremia virus.
[0044] The above-mentioned design-specific primer sequences and fluorescent probe sequences:
[0045] Search the gene sequence of carp spring viremia virus in the GenBank database, use BioEdit 7.9 software for gene sequence comparison analysis, and analyze and compare the evolution rate of each gene by BEAST 1.8 software. The results show that, compared with the G gene, carp spring viremia virus The nucleoprotein N gene of viruses is more conserved. Therefore, according to the conserved region of the N gene, use Primer Express 3.0 software to design and screen specific primer sequences and fluorescent probe sequences, wherein the specific primer sequences include forward primers and reverse primers, and the fluorescent probes are TaqMan p...
Embodiment 2
[0056] Taking carp samples as an example, SYBR GREEN I fluorescent dye method was used to detect carp spring viremia virus.
[0057] Six carp samples to be tested were collected from a farm in Minhang, Shanghai. Anatomy showed that there were no obvious clinical symptoms of carp spring viremia, and whether they carried carp spring viremia virus was tested.
[0058] Get the mixed homogenate tissue of liver, spleen, kidney and brain of 30 mg carp to be tested, total RNA extraction and cDNA synthesis are the same as in Example 1, the specific primers and probe sequences used are the same as in Example 1, and the SYBR GREEN I fluorescent dye method only Specific primers are required, no fluorescent probes are required.
[0059] SYBR GREEN I real-time quantitative PCR reaction system and reaction procedures are the same as described in 4 of the technical scheme. 7500Fast fluorescent quantitative PCR instrument was used for the reaction, and the reaction condition was 95°C for 30 s...
Embodiment 3
[0062] The sensitivity of the fluorescent quantitative PCR detection method using the specific primers and probes for the N gene designed by the present invention and the primers and probes for the G gene in the carp spring viremia quarantine technical specification SN / T 1152-2011 Compare.
[0063] Take 20 healthy carp for artificial infection experiment. After 14 days of virus inoculation, different tissues of liver, spleen, kidney, brain, muscle and testis of infected carp were sampled respectively. Total RNA extraction and cDNA synthesis are the same as in Example 2. The N Gene-specific primers and probes are the same as in Example 1.
[0064] The primers and probes for the G gene used are as follows:
[0065] SVCV-GF: ATCATTCAAAGGATTGCATCAG;-
[0066] SVCV-GR: CATATGGCTCTAAATGAACAGAA;
[0067] SVCV-G-tag: FAM-TCCCCCTCAAAGTTGCGGATGG-TRAMA
[0068] The fluorescent probe was labeled with the fluorescent reporter group FAM at the 5' end of the fluorescent probe and the flu...
PUM
| Property | Measurement | Unit |
|---|---|---|
| melting point | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
