Application of a soybean e3 ubiquitin ligase gene gmpub2 that regulates plant flowering

A ubiquitin ligase and gene technology, which is applied in the application field of soybean E3 ubiquitin ligase gene GmPUB2, can solve the problems of no soybean E3 ubiquitin ligase and the like

Active Publication Date: 2018-04-03
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, the function of E3 ubiquitin ligase in the regulation of plant response to biotic and abiotic stress has been more and more studied, and its regulation in plant growth and development has gradually been recognized, but there is no soybean E3 ubiquitin ligase. Report on the Participation of Ligase in Regulating Flowering in Plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a soybean e3 ubiquitin ligase gene gmpub2 that regulates plant flowering
  • Application of a soybean e3 ubiquitin ligase gene gmpub2 that regulates plant flowering
  • Application of a soybean e3 ubiquitin ligase gene gmpub2 that regulates plant flowering

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1: Obtaining of GmPUB2 gene

[0029] 1. RNA extraction:

[0030] (1) Sample processing: collect about 100 mg of soybean leaf tissue, grind it in liquid nitrogen, add 1 mL of lysate RZ, shake and mix.

[0031] (2) Place the homogenized sample at room temperature for 5 minutes to completely separate the nucleic acid-protein complex.

[0032] (3) Centrifuge at 12,000 rpm for 5 minutes at 4°C, take the supernatant, and transfer it to a new RNase-free centrifuge tube.

[0033] (4) Add 200 μl of chloroform, cover the tube cap, shake vigorously for 15 sec, and place at room temperature for 3 min.

[0034] (5) 4°C, 12000rpm centrifuge for 10min, the sample will be divided into three layers: RNA is mainly in the water phase, transfer the water phase to a new tube, and proceed to the next step.

[0035] (6) Slowly add 0.5 times the volume of absolute ethanol, mix well, transfer to the adsorption column CR3, centrifuge at 12000rpm at 4°C for 30sec, and discard the wa...

Embodiment 2

[0062] Embodiment 2: Construction of plant expression vector

[0063] 1. Obtaining of attB-GmPUB2 product

[0064] According to the Gateway system, linkers attB1 and attB2 are added to the 5' end of the specific primers for amplifying the target gene, and then the DNA is amplified with KOD polymerase to amplify the full-length fragment of the target gene with the linker (attB).

[0065] attB1+GmPUB2F2: 5'‐GGGGACAAGTTTGTACAAAAAAGCAGGCT‐3' (SEQ ID NO.5)

[0066] attB2+GmPUB2R2: 5'‐GGGGACCACTTTGTACAAGAAAGCTGGGT‐3' (SEQ ID NO.6)

[0067] Soybean cDNA was used as a template, and attB1+GmPUB2F2 and attB2+GmPUB2R2 were used as upstream and downstream primers for PCR amplification. The PCR conditions were 94°C for 2min, 94°C for 30sec, 68°C for 2min, 35 cycles, and 68°C for 5min. After the PCR product was sent to BGI for sequencing verification, it was separated and analyzed with 1.0% agarose gel, and the target fragment was recovered and purified.

[0068] 2. Construction of entry...

Embodiment 3

[0076] Example 3: Transformation of Arabidopsis and verification of transgene function

[0077] 1. Transformation of Agrobacterium with pMDC83‐GmPUB2 vector

[0078] Extract the pMDC83-GmPUB2 plasmid, mix it with Agrobacterium EHA105, and transform it by freeze-thaw method. Positive clones were screened on LB medium containing 50 mg / L Rif and 50 mg / L Kan. Then use the upstream primer F1 of GmPUB2 and the downstream primer R1 of GmPUB2 as primers to carry out PCR amplification to detect whether the selected single clone contains the target gene fragment. After the verified clones were multiplied, they were stored at -80°C for later use.

[0079] 2. Genetic Transformation of Arabidopsis

[0080] (1) Seed disinfection: Soak Arabidopsis wild-type seeds in a 1.5mL centrifuge tube containing 1mL deionized water, place it at 4°C for 2 days, take it out, wash it twice with sterilized water in an ultra-clean bench, and suck it away water. Add 75% alcohol to the centrifuge tube, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of soybean E3 ubiquitin ligase gene GmPUB2 for regulating plant flowering. Application of soybean E3 ubiquitin ligase gene GmPUB2 regulating plant flowering in regulating plant flowering. The GmPUB2 gene is transferred into the target plant through the plant expression vector to obtain the late flowering plant. The GmPUB2 gene is transferred into the target plant through the gene silencing vector to obtain the early flowering plant. The target gene GmPUB2 was transformed into Arabidopsis. Compared with wild-type Arabidopsis, it was proved that the bolting and flowering time of the transgenic plants were significantly later than those of the wild-type, indicating that the GmPUB2 gene has the effect of delaying plant flowering. Using the constructed GmPUB2 gene silencing vector, the transgenic Arabidopsis overexpressing the target gene GmPUB2 was silenced, and it was proved that the flowering time of the silenced plants was significantly earlier than that of the control plants.

Description

technical field [0001] The invention belongs to the technical field of biological genetic engineering and relates to the application of soybean E3 ubiquitin ligase gene GmPUB2 for regulating plant flowering. Background technique [0002] Flowering is an important process for plants to transform from vegetative growth to reproductive growth. Flowering time is an important agronomic trait, which determines whether crops adapt to the light temperature and growing cultivation season in a specific area. Plant flowering is a key point in the transition of plants from vegetative growth to reproductive growth, and it has strong plasticity. Under the influence of various external environments and internal factors, plants will choose to flower at an appropriate time and turn to reproductive growth. By adjusting the flowering period, the plants can delay or advance the flowering, so as to control the vegetative growth or reproductive growth of the plants, avoid the damage to the crops...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/52C12N9/00C12N15/82A01H6/20
Inventor智海剑王大刚王丽群何卓伟杨永庆杨云华林静
OwnerNANJING AGRICULTURAL UNIVERSITY