A kind of Amaranth monooxygenase cmo and its coding gene and application

A monooxygenase, white bone soil technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve problems such as not reaching the industrialization standard

Active Publication Date: 2019-04-16
BIOCENTURY TRANSGENE CHINA
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although many research institutions have obtained various types of transgenic plants with certain resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Amaranth monooxygenase cmo and its coding gene and application
  • A kind of Amaranth monooxygenase cmo and its coding gene and application
  • A kind of Amaranth monooxygenase cmo and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1. Construction of A. chinensis SSH library under salt stress:

[0024] The specific method is:

[0025] According to Clontech's PCR-select TM The method shown in the cDNA Subtraction Kit kit manual was used to construct the SSH library (suppression subtraction library) by the suppression subtractive hybridization method. During the experiment, the mRNA extracted from the root of the salt-treated A. japonicum was used as the sample (Tester), and the mRNA extracted from the untreated A. japonicum root was used as the control (Driver). Specific steps are as follows:

[0026] (1) Test materials:

[0027] Bone soil was collected from Futian National Nature Reserve, Shenzhen, Guangdong Province (N22°53′, E114°01′). Hypocotyls from Aricennia marina without pests, well developed, and similar in maturity were collected, and hypocotyls of similar size, length, and weight were selected for the experiment. In plastic barrels (basin caliber 18cm, height 15cm), plastic...

Embodiment 2

[0038] Example 2 Cloning of A. marina monooxygenase encoding gene AmCMO

[0039] After removing redundant DNA from the identified clone numbered Am-SL-125 in the B. marina SSH library, the sequence is SEQ ID No: 3. Sequence analysis shows that the protein encoded by this sequence belongs to monooxygenase. In this paper, the full-length coding gene corresponding to the sequence of SEQ ID No: 3 is named AmCMO, and the corresponding protein is named CMO.

[0040] SEQ ID No: 3:

[0041]

[0042] Cloning of AmCMO full-length coding gene

[0043] According to the obtained sequence of SEQ ID No: 3, the following two specific primers were designed as the 5' end specific primers of 3' RACE.

[0044] AmCMO GSP1: SEQ ID No: 4:

[0045] TGTGACAACT ATTTAGATGG TGG

[0046] AmCMO GSP2: SEQ ID No: 5:

[0047] GGTCTCCAGCTTGATTCGTATTC

[0048] The experimental steps were operated according to the instructions of the kit (the 3'RACE System for Rapid Amplification of cDNA Ends kit was pu...

Embodiment 3

[0083] Example 3 AmCMO Gene Plant Expression Vector Construction

[0084] The plant binary expression vector pCAMBIA2300 (purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd.) was selected as the plant expression vector, and the 35S promoter of the NPTII gene containing double enhancers was replaced with the Pnos promoter to reduce the expression of NPTII protein in plants . The 35S promoter and the Tnos terminator were selected as the promoter and terminator of the AmCMO gene, respectively, and the construction flow chart is shown in Figure 1.

[0085] Primers SEQ ID NO: 12 and SEQ ID NO: 13 were used to amplify Pnos with the plant expression vector pBI121 plasmid (purchased from Beijing Huaxia Ocean Technology Co., Ltd.) as a template, and PrimeSTAR HS DNA polymerase of TAKARA was used. 50 μl PCR reaction system: 10 μl 5×PS Buffer, 3 μl 2.5 mM dNTP, 1.0 μl pBI121 plasmid, 1.0 μl PrimeSTAR HS DNA polymerase, 10 μM primers SEQ ID NO: 12 and 2.0 μl each of SEQ ID ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

Disclosed are a monooxygenase CMO derived from Avicennia marina and a coding gene thereof, and a use of the coding gene in the cultivation of transgenic plants having improved salt tolerance and drought tolerance.

Description

technical field [0001] The present invention relates to plant protein and its encoding gene and application, in particular to a monooxygenase CMO and its encoding gene derived from A. chinensis, and its application in cultivating transgenic plants with improved salt tolerance and drought tolerance . Background technique [0002] Drought restricts the planting of crops on more than 40% of the earth's land area, and poses a serious threat to global agricultural production and food supply. Drought is one of the main environmental constraints on crop yield. [0003] The area of ​​saline-alkali soil in the world is very large, about 400 million hectares, accounting for 1 / 3 of irrigated farmland. In semi-arid and arid areas with dry climate, due to low rainfall and intense evaporation, salt accumulates continuously; in coastal areas, soil salt content increases due to seawater intrusion. Saline-alkali soil in my country is mainly distributed in Northwest, North China, Northeast ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N15/82A01H4/00A01H5/00A01H6/46
CPCC12N15/8273C12N9/0069
Inventor 王建胜何云蔚田大翠梁丽
Owner BIOCENTURY TRANSGENE CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap