Saccharomyces cerevisiae mating type conversion method
A mating type and yeast technology, applied in the field of molecular biology, can solve the problems of long experimental cycle and achieve the effect of short experimental cycle and rapid conversion
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0054] The SC-Leu liquid medium involved in the preparation method of competent cells in the present invention is a synthetic complete liquid medium with default leucine. The specific preparation method of SC-Leu liquid medium is to synthesize yeast nitrogen source YNB 6.7g / L, glucose 20g / L, and leucine-deficient mixed amino acid powder 2g / L. The YPD involved is yeast extract peptone glucose medium. The specific preparation method of YPD is yeast extract 10g / L, peptone 20g / L, and glucose 20g / L.
[0055] In some embodiments, the competent cells are yeast strain BY4741 competent cells comprising plasmid pRS415+Cas9.
[0056] In other embodiments, the competent cells are yeast strain BY4742 competent cells comprising plasmid pRS415+Cas9.
[0057] In the method for transforming the mating type of yeast of the present invention, the transformation system comprises plasmid DNA, and the plasmid DNA includes a guide-RNA plasmid and a plasmid fragment of the MAT gene expression casse...
Embodiment 1
[0102] Using the CRISPR / Cas9 technology-based Saccharomyces cerevisiae mating type conversion technology, the mating type conversion of Saccharomyces cerevisiae BY4741 includes the following steps:
[0103] 1. The plasmid pRS415+Cas9 carrying the Cas9 gene was transformed into Saccharomyces cerevisiae strain BY4741 by LiOAc transformation method, and the transformed cells were spread on SC-Leu plates for screening, and cultured at 30°C for 2 days. Pick the single clone transformant and streak it on the SC-Leu plate for purification.
[0104] 2. To construct a guide-RNA plasmid whose target site is MATa, the construction steps are as follows:
[0105] a) Select protospacer as acaaaaatttttctaacaat;
[0106] b) Synthetic primers: "GCAGTGAAAGATAAATGATCacaaaaatatttctaacaatGTTTTAGAGCTAGAAATAGC" and "GCTATTTCTAGCTCTAAAACattgttagaaatatttttgtGATCATTTATCTTTCACTGC";
[0107] c) annealing and bonding two primers to obtain double-stranded DNA;
[0108] d) using restriction endonucleases...
Embodiment 2
[0134] Using the CRISPR / Cas9 technology-based Saccharomyces cerevisiae mating type conversion technology, the mating type conversion of Saccharomyces cerevisiae BY4742 includes the following steps:
[0135] 1. The plasmid pRS415+Cas9 carrying the Cas9 gene was transformed into Saccharomyces cerevisiae strain BY4742 by LiOAC transformation method, and the transformed cells were spread on SC-Leu plates for screening, and cultured at 30°C for 2 days. Pick the single clone transformant and streak it on the SC-Leu plate for purification.
[0136] 2. To construct a guide-RNA plasmid whose target site is MATα, the construction steps are as follows:
[0137] a) Select protospacer as caaatcatacagaaacacag;
[0138] b) Synthetic primers:
[0139] "GCAGTGAAAGATAAATGATCcaaatcatacagaaacacagGTTTTAGAGCTAGAAATAGC" and
[0140] "GCTATTTCTAGCTCTAAAACctgtgtttctgtatgatttgGATCATTTATCTTTCACTGC";
[0141] c) annealing and bonding two primers to obtain double-stranded DNA;
[0142] d) using restric...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
