Saccharomyces cerevisiae mating type conversion method

A mating type and yeast technology, applied in the field of molecular biology, can solve the problems of long experimental cycle and achieve the effect of short experimental cycle and rapid conversion

Active Publication Date: 2016-04-13
TIANJIN UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, after using the HO gene to induce the conversion of the mating type of Saccharomyces cerevisiae cells, the cross-mating cells will immediately contact each other to produce diploid cells, so sporulation experiments are still needed to obtain haploid strains, and the experimental cycle is longer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharomyces cerevisiae mating type conversion method
  • Saccharomyces cerevisiae mating type conversion method
  • Saccharomyces cerevisiae mating type conversion method

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0054] The SC-Leu liquid medium involved in the preparation method of competent cells in the present invention is a synthetic complete liquid medium with default leucine. The specific preparation method of SC-Leu liquid medium is to synthesize yeast nitrogen source YNB 6.7g / L, glucose 20g / L, and leucine-deficient mixed amino acid powder 2g / L. The YPD involved is yeast extract peptone glucose medium. The specific preparation method of YPD is yeast extract 10g / L, peptone 20g / L, and glucose 20g / L.

[0055] In some embodiments, the competent cells are yeast strain BY4741 competent cells comprising plasmid pRS415+Cas9.

[0056] In other embodiments, the competent cells are yeast strain BY4742 competent cells comprising plasmid pRS415+Cas9.

[0057] In the method for transforming the mating type of yeast of the present invention, the transformation system comprises plasmid DNA, and the plasmid DNA includes a guide-RNA plasmid and a plasmid fragment of the MAT gene expression casse...

Embodiment 1

[0102] Using the CRISPR / Cas9 technology-based Saccharomyces cerevisiae mating type conversion technology, the mating type conversion of Saccharomyces cerevisiae BY4741 includes the following steps:

[0103] 1. The plasmid pRS415+Cas9 carrying the Cas9 gene was transformed into Saccharomyces cerevisiae strain BY4741 by LiOAc transformation method, and the transformed cells were spread on SC-Leu plates for screening, and cultured at 30°C for 2 days. Pick the single clone transformant and streak it on the SC-Leu plate for purification.

[0104] 2. To construct a guide-RNA plasmid whose target site is MATa, the construction steps are as follows:

[0105] a) Select protospacer as acaaaaatttttctaacaat;

[0106] b) Synthetic primers: "GCAGTGAAAGATAAATGATCacaaaaatatttctaacaatGTTTTAGAGCTAGAAATAGC" and "GCTATTTCTAGCTCTAAAACattgttagaaatatttttgtGATCATTTATCTTTCACTGC";

[0107] c) annealing and bonding two primers to obtain double-stranded DNA;

[0108] d) using restriction endonucleases...

Embodiment 2

[0134] Using the CRISPR / Cas9 technology-based Saccharomyces cerevisiae mating type conversion technology, the mating type conversion of Saccharomyces cerevisiae BY4742 includes the following steps:

[0135] 1. The plasmid pRS415+Cas9 carrying the Cas9 gene was transformed into Saccharomyces cerevisiae strain BY4742 by LiOAC transformation method, and the transformed cells were spread on SC-Leu plates for screening, and cultured at 30°C for 2 days. Pick the single clone transformant and streak it on the SC-Leu plate for purification.

[0136] 2. To construct a guide-RNA plasmid whose target site is MATα, the construction steps are as follows:

[0137] a) Select protospacer as caaatcatacagaaacacag;

[0138] b) Synthetic primers:

[0139] "GCAGTGAAAGATAAATGATCcaaatcatacagaaacacagGTTTTAGAGCTAGAAATAGC" and

[0140] "GCTATTTCTAGCTCTAAAACctgtgtttctgtatgatttgGATCATTTATCTTTCACTGC";

[0141] c) annealing and bonding two primers to obtain double-stranded DNA;

[0142] d) using restric...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular biology, in particular to a saccharomyces cerevisiae mating type conversion method. According to the saccharomyces cerevisiae mating type conversion method, a Cas9 protein is utilized to produce a double-strand break at an MAT locus, the double-strand break is repaired by an exogenous introduced MAT fragment for conversion of saccharomyces cerevisiae mating types. The saccharomyces cerevisiae mating type conversion method can efficiently and quickly convert saccharomyces cerevisiae haploid mating types and does not rely on saccharomyces cerevisiae chromosome structures HML alpha and HMRa itself, a diploid saccharomyces cerevisiae stage is omitted, induction and other treatment conducted on saccharomyces cerevisiae strains to be converted are not needed, anti-mating type saccharomyces cerevisiae strains are directly obtained, and an experiment period is short.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a method for converting the mating type of yeast, in particular to a method for rapidly converting the mating type of Saccharomyces cerevisiae. Background technique [0002] Saccharomyces cerevisiae, also known as baker's yeast or budding yeast. Saccharomyces cerevisiae is the most widely related yeast, not only because it is traditionally used to make food such as bread and steamed bread and wine, but also used as a eukaryotic model organism in modern molecular and cellular biology, and its role is equivalent to that of prokaryotic cells. Model organism Escherichia coli. Saccharomyces cerevisiae has two common lifestyles, haploid and diploid. Haploids have a simpler life cycle and reproduce by mitosis. It usually dies in times of high environmental stress. Diploid cells (the predominant form of yeast) also reproduce by simple mitosis, but can enter meiosis when external cond...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/81C12N15/66
CPCC07K14/395C12N15/66C12N15/81C12N2800/102C12N2800/80
Inventor元英进谢泽雄李炳志
OwnerTIANJIN UNIV