Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

LRR-RLK receptor kinase AtMDIS1 and application thereof in breaking reproductive isolation between species

A species and plant technology, applied to LRR-RLK receptor kinase AtMDIS1 and its application fields, can solve problems such as hindering gene exchange, hybrid sterility, and difficulties in agricultural production, and achieve the effects of increasing fertilization efficiency and improving efficiency

Active Publication Date: 2016-04-20
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The essence of all kinds of reproductive isolation is to hinder the gene exchange between different species. This isolation phenomenon has caused difficulties in agricultural production, such as hybrid sterility during hybridization, making it impossible for people to use heterosis for breeding
This reproductive isolation has caused certain negative effects on agricultural production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LRR-RLK receptor kinase AtMDIS1 and application thereof in breaking reproductive isolation between species
  • LRR-RLK receptor kinase AtMDIS1 and application thereof in breaking reproductive isolation between species
  • LRR-RLK receptor kinase AtMDIS1 and application thereof in breaking reproductive isolation between species

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1. AtMDIS1 Transformation of Capsellarubella Positive Plants Screening and Identification of Gene Expression.

[0035] 1. Preparation of AtMDIS1 gene expression vector pLAT52:AtMDIS1-NOST driven by LAT52 promoter based on pBI101.

[0036] First, use the Arabidopsis genomic DNA as a template to amplify the DNA fragment of the AtMDIS1 gene with the nucleotide sequence shown in SEQIDNo.: 1, and the amplification primer is MDIS1-F1: TCCC CCCGGG ATGGGTTGTCGATGGAATCCAATT (SEQ ID No.: 4); MDIS1-R1: TCCC CCCGGG TTATGTAGCTTCAGAGGATAAGATCT (SEQ ID No.: 5) (the XmaI restriction site is underlined, and the 5' end of the restriction site is a protective base). The AtMDIS1 fragment was amplified from pollen with TOYOBOKODPlus enzyme, and the amplified product was digested with XmaI and recovered; the pBI101 vector (available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences) was digested with HindⅢ and dephosphorylated with...

Embodiment 2

[0044] Embodiment 2, test optimum Capsellarubella pollen germination medium Carry out Capsellarubella pollen germination test

[0045] Adjust the prepared pollen germination medium to pH 7.5, add Promega's low-melting point agarose (article number V2111) and boil in a water bath until the agarose is completely dissolved, and then place it in a small petri dish (diameter 3.2cm) after cooling to room temperature. , NEST Company, Cat. No. GBD-35-15), pour 1-2 mL of medium into it, and place it in a refrigerator at 4°C for 1-2 hours until it is completely solidified.

[0046] Spread wild-type Capsellarubella pollen evenly on the prepared medium under a dissecting microscope, put wet toilet paper under the small petri dish, and germinate in a constant temperature greenhouse for 8 hours, then count the ratio of germinated pollen / total pollen , to calculate the germination rate.

[0047] Table 1 explores the pollen germination efficiency statistics of the more optimized Capsellarube...

Embodiment 3

[0052] Example 3. Detection of the efficiency of pollen of AtMDIS1 transgenic plants entering mature unfertilized Arabidopsis ovules.

[0053] Arabidopsis thaliana and Capsellarubella were detasseled one day before flowering (use hybrid tweezers to peel off the petals of the small buds that have just turned white, and remove all the anther filaments).

[0054] The pollen of Capsellarubella was pollinated to the unfertilized stigma, and after 30 minutes, the stigma was cut off and placed flat on the pollen germination medium. After culturing for 8 hours, unfertilized ovules of Arabidopsis thaliana were placed near the pollen tube.

[0055] When cultured at 24° C. for 12-14 hours, the efficiency of transgenic pollen tube orientation to ovules was observed under a Leica DM4000 BLED fluorescent microscope.

[0056] Apply aniline blue staining solution (1% w / v aniline blue, SIGMA product number 415049), 100 mM K 3 (PO 4 ) (Sinopharm Group Chemical Reagent Beijing Co., Ltd., pH 10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses LRR-RLK receptor kinase AtMDIS1 having high expression in arabidopsis plant pollen and a method for breaking a close hybridization barrier through AtMDIS1. AtMDIS1 is expressed in species except arabidopsis through a transgenic means, gene exchange between different species can be promoted, and the hybrid sterility barrier in hybridization breeding is broken. Experiments prove that the method can successively improve arabidopsis ovule recognition efficiency of close species plant male gametophytes.

Description

technical field [0001] The application relates to but not limited to the field of biotechnology, in particular to the Arabidopsis LRR-RLK (Leucine-richrepaeat-receptorlikekinase) receptor kinase AtMDIS1 ( M ale dis cover 1 ) and its application; more specifically, it relates to a technique for breaking the reproductive isolation between species by transgenic means through transgenic means of the LAT52 promoter specifically expressed in pollen to drive the Arabidopsis receptor kinase encoding gene AtMDIS1. Background technique [0002] Due to various reasons, the isolation mechanism in which groups with close kinship do not mate under natural conditions, or even if they can mate, cannot produce offspring or produce fertile offspring, is called reproductive isolation. If reproductive isolation occurs before fertilization, it is called pre-fertilization reproductive isolation, including geographical isolation, ecological isolation, seasonal isolation, physiological isolation,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N15/29C12N15/82A01H5/00
CPCC12N9/1205C12N15/8261C12Y207/01037
Inventor 杨维才李红菊王童陈伟
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More