Unlock instant, AI-driven research and patent intelligence for your innovation.

High-xylose-tolerance difunctional hemicellulolytic enzyme and encoding gene and preparation method thereof

A hemicellulose and dual-function technology, applied in the field of genetic engineering, can solve the problems of low xylose tolerance and difficulty in meeting industrial needs, and achieve the effects of reducing anti-nutritional effects, increasing fragrance, and increasing concentration

Inactive Publication Date: 2016-05-04
YUNNAN NORMAL UNIV
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This enzyme not only has the functions of arabinosidase and xylosidase, but also can maintain a high activity in a low temperature environment, but the enzyme's xylose tolerance is small, and its environmental adaptability is still difficult to meet the needs of existing industries

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-xylose-tolerance difunctional hemicellulolytic enzyme and encoding gene and preparation method thereof
  • High-xylose-tolerance difunctional hemicellulolytic enzyme and encoding gene and preparation method thereof
  • High-xylose-tolerance difunctional hemicellulolytic enzyme and encoding gene and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1: Cloning of gene XylRBM26

[0048] Extract Massiliasp.RBM26 genomic DNA: centrifuge the bacterial liquid cultured in liquid for 2 days to get the thallus, add 1mL lysozyme, treat at 37°C for 1h, then add the lysate, the lysate consists of: 50mM Tris, 20mM EDTA, NaCl500mM, 2% SDS (w / v), pH 8.0, lysed in a water bath at 70°C for 1 hour, mixed every 10 minutes, and centrifuged at 10,000 rpm for 5 minutes at 4°C. The supernatant was extracted in phenol / chloroform to remove impurity proteins, and then an equal volume of isopropanol was added to the supernatant. After standing at room temperature for 5 minutes, centrifuge at 10,000 rpm for 10 minutes at 4°C. The supernatant was discarded, the precipitate was washed twice with 70% ethanol, dried in vacuum, dissolved by adding an appropriate amount of TE, and stored at -20°C for later use.

[0049]5 μg of Massiliasp.RBM26 genome was broken into fragments of 400-600 bp with an ultrasonic breaker Biorupter, and the br...

Embodiment 2

[0051] Example 2: Preparation of recombinant bifunctional hemicellulose degrading enzyme XylRBM26

[0052] According to the sequence analysis results of the bifunctional hemicellulose degrading enzyme gene XylRBM26, the primers for amplifying the mature peptide were designed:

[0053] XylRBM26F: ATGATCCACAACCCGATCCTGC

[0054] XylRBM26R: CAGCCGGCTGAGGTAGGGCC

[0055] Using the genome of strain Massiliasp.RBM26 as a template, the above primers amplify the target gene by PCR. The PCR reaction parameters were pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30S, annealing at 72°C for 30S, extension at 72°C for 1min30S, a total of 20 cycles; denaturation at 94°C for 30S, annealing at 52°C for 30S, and extension at 72°C for 1min30S, a total of 10 cycles; After amplification at 72°C, it was extended for 7 minutes; the temperature was decreased by 1°C for each cycle from 72°C to 52°C.

[0056] The bifunctional hemicellulose degrading enzyme gene XylRBM26 and the ex...

Embodiment 3

[0058] Example 3 Determination of the properties of the purified recombinant bifunctional hemicellulose degrading enzyme XylRBM26

[0059] 1. Activity analysis of purified recombinant bifunctional hemicellulose degrading enzyme XylRBM26

[0060] The method for measuring the activity of the recombinant bifunctional hemicellulose-degrading enzyme XylRBM26 adopts the pNPX method: pNPX is dissolved in 0.1M buffer to make the final concentration 2mM. 450μL of 2mM substrate; after preheating at the reaction temperature for 5min, add 50μL of an appropriate amount of diluted enzyme solution, and after 10min of reaction, add 2mL of 1M Na 2 CO 3 Terminate the reaction, measure the released pNP at a wavelength of 405nm after cooling to room temperature; 1 enzyme activity unit (U) is defined as the amount of enzyme required to decompose pNPX to produce 1 μmol pNP per minute (the enzyme activity determination method of the pNP substrate is the same as that of pNPX) . 3,5-dinitrosalicyli...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a high-xylose-tolerance difunctional hemicellulolytic enzyme and a preparation method and application thereof. The amino acid encoding sequence of the enzyme is shown as SEQ ID NO.2 and comprises 542 amino acids, and the theoretical molecular weight of the enzyme is 61.85 kDa. The high-xylose-tolerance difunctional hemicellulolytic enzyme (XylRBM26) has the activity of beta-D-xylosidase and the activity of alpha-L-Arabinfuranosidease, the higher activity (the Ki value is 500 mM) can be kept in a high-xylose environment, the optimum pH is 6.5, and the optimum temperature is 50 DEG C; 95% or above of the activity still can be kept after the enzyme tolerates the condition at 45 DEG C for 60 min, and xylobiose, xylotriose and xylotetraose can be thoroughly hydrolyzed into xylose. The enzyme can serve as a novel enzymic preparation and can be widely applied to food, feed, energy industry and the like.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a bifunctional hemicellulose degrading enzyme with high xylose tolerance, its coding gene and its preparation method. Background technique [0002] Xylan is the main component of plant hemicellulose, and xylose is the final product of its complete degradation. The completion of the entire hydrolysis process requires the synergy of xylanases. Xylanase mainly includes: endo-1, 4-β-D-xylanase (endo-l, 4-β-D-xylanohydrolase, EC3.2.1.8), which mainly cuts xylan randomly The main chain generates xylooligosaccharides of different lengths; β-xylosidase (β-D-xylosidase, EC3.2.1.37), acts on oligosaccharides and xylobiose to eventually degrade them into xylose; and a-D-glucose Aldosidase (a-D-glucatronidase, EC3.2.1.139), acetylxylanesterase (acetylxylanesterase, EC3.1.1.72), a-L-arabinofuranosidase (a-L-arabinofuranosidase, EC3.2.1.55), Enzymes such as ferulic ac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/63C12N1/21C12N1/15C12N1/19A23L29/00A23K20/189
CPCC12N9/2402C12N9/248C12Y302/01037C12Y302/01088
Inventor 许波戴利铭黄遵锡李俊俊唐湘华杨云娟
Owner YUNNAN NORMAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More