Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Quick extraction method for total DNA of yeast-like fungi for nucleic acid amplification

A yeast-like fungus and extraction method technology, which is applied in the field of rapid extraction of total DNA of yeast-like fungi, can solve the problems of slow kit speed, DNA degradation, difficulty in transportation and storage, and achieve no irritating smell, high extraction rate, large The effect of the extraction effect

Inactive Publication Date: 2016-05-18
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY +1
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are multiple commercially available kits and classic laboratory methods, there are multiple defects as follows: 1. The kit is expensive, and YeaStar TM GenomicDNAKit Yeast Extraction Kit, for example, extracts nearly 25 yuan per sample, and zymoZRFungal / BacterialDNAKit extraction kit extracts nearly 20 yuan per sample; 2. The extraction speed is slow, because most commercially available kits and laboratory methods have added The digestion steps of proteinase K and helicase make the extraction time process take several hours, such as Sangon EzupColumnYeastGenomicDNAPurificationKit kit, only the enzyme digestion step needs more than four hours (one hour for proteinase K, three hours for helicase); 3. Transportation Preservation is difficult, because protease activity is more sensitive to transportation conditions, the kit has certain requirements for transportation and storage
4. Toxic and harmful substances, such as benzyl chloride in the benzyl chloride extraction method is a carcinogen, phenol chloroform in the classic phenol chlorine extraction method will also stimulate the human respiratory tract, and the mercaptoethanol commonly used in the kit is highly toxic. has a strong stench
5. Most of the commercial kits and the existing extraction methods in the laboratory are not effective in extracting a small amount of fungi, so they lack the potential for clinical diagnosis
[0007] 2. Enzymatic hydrolysis: degrade the fungal cell wall through proteinase K, helicase, etc., but this process usually takes several hours, which is what causes YeaStar TM Genomic DNA Kit, Takara Dr. (fromYeast) HighRecovery, EzupColumnYeastGenomicDNAPurificationKit and other kits are the main reason for the slow speed;
[0008] 3. Chemical lysis: using a lysate mainly composed of urea, guanidine salt, strong acid, strong base, etc., to lyse the fungal cell wall, but the simple chemical lysis has a very limited effect on the fungal cell wall, and the extraction efficiency is not high;
This method is reliable in breaking the wall, but because the mechanical breaking of the wall will also lead to DNA degradation, the destruction of the cell wall to obtain DNA and the fragmentation and consumption of DNA are a pair of contradictions under this method.
For example, when the glass beads continue to hit the cell wall, it will also cause continuous degradation of the hydrated DNA already in the extract.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quick extraction method for total DNA of yeast-like fungi for nucleic acid amplification
  • Quick extraction method for total DNA of yeast-like fungi for nucleic acid amplification
  • Quick extraction method for total DNA of yeast-like fungi for nucleic acid amplification

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Embodiment 1: extract DNA effect:

[0051] Five fungi were selected for DNA extraction:

[0052] Table 1 This method is for the extraction effect of a large amount of fungi

[0053]

[0054]

[0055] Total is 10 7 -10 1 After extracting DNA from the above strains by TCM method, the results of real-time fluorescent quantitative PCR (RT-PCR) using NS5 and NS6 fungal universal primers were all amplified successfully. No amplification was seen in the no-template control (NTC).

[0056] Primer sequence:

[0057] NS5:AACTTAAAGGAATTGACGGAAG (SEQ ID NO.1)

[0058] NS6: GCATCACAGACCTGTTATTGCCTC (SEQ ID NO. 2)

[0059] The amplification system is:

[0060] PremixExTaq TM II (TliRNaseHPlus) (takara) 12.5μl

[0061] NS51μl

[0062] NS61μl

[0063] DNA template 10.5μl

[0064] 25μl total

[0065] Amplification conditions

[0066] 95°C for 30 seconds-{95°C for 5 seconds-55°C for 30 seconds-72°C for 60 seconds} a total of 40 cycles-95°C for 5 seconds-60°C for 30 ...

Embodiment 2

[0068] Embodiment 2: Comparison with other extraction methods

[0069] The comparison between the method of the present invention and other fungal extraction kits is shown in Table 2, and the comparison with other methods reported in the literature is shown in Table 3.

[0070] Table 2 Comparison with other fungal extraction kits

[0071]

[0072]

[0073] Table 3 Comparison with methods reported in the literature

[0074]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular biology of fungi, in particular to a quick extraction method for total DNA of yeast-like fungi for nucleic acid amplification. The method integrates the freeze-thaw method, the chemical cleavage method and the mechanical wall-breaking method skillfully, DNA extraction is completed within 10-20 min, and the cheap, non-toxic and efficient fungus DNA extraction method is the fastest so far. The extraction method has the advantages of quickness, sensitivity, non-toxicity, cheapness and the like and is applicable to most of the yeast-like fungi.

Description

technical field [0001] The invention relates to the research field of molecular biology of fungi, in particular to a method for rapidly extracting total DNA of yeast-like fungi for nucleic acid amplification. Background technique [0002] In recent decades, great progress in the field of biomedicine has promoted the remarkable improvement of human disease prevention and control capabilities. However, with the widespread use of hematopoietic stem cell and solid organ transplantation, tumor chemotherapy, immunosuppressants, broad-spectrum antibiotics, various catheterization techniques, and the continued spread of HIV around the world, the morbidity and mortality of various invasive fungal infections There is a significant upward trend globally. For example, according to conservative estimates, there are 250,000 new cases of invasive candidiasis each year in medically developed areas, causing more than 50,000 deaths, and the population prevalence rate is 2-14 per 100,000 peop...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10C12Q1/68C12R1/645
CPCC12N15/10C12Q1/68C12Q1/6806C12Q1/686C12Q2563/149
Inventor 方文捷洪南陈敏潘炜华廖万清尤其敏俞世冲刘加李娟李颖芳赵海霞吴俊琪孙刚
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products