Quick extraction method for total DNA of yeast-like fungi for nucleic acid amplification
A yeast-like fungus and extraction method technology, which is applied in the field of rapid extraction of total DNA of yeast-like fungi, can solve the problems of slow kit speed, DNA degradation, difficulty in transportation and storage, and achieve no irritating smell, high extraction rate, large The effect of the extraction effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Embodiment 1: extract DNA effect:
[0051] Five fungi were selected for DNA extraction:
[0052] Table 1 This method is for the extraction effect of a large amount of fungi
[0053]
[0054]
[0055] Total is 10 7 -10 1 After extracting DNA from the above strains by TCM method, the results of real-time fluorescent quantitative PCR (RT-PCR) using NS5 and NS6 fungal universal primers were all amplified successfully. No amplification was seen in the no-template control (NTC).
[0056] Primer sequence:
[0057] NS5:AACTTAAAGGAATTGACGGAAG (SEQ ID NO.1)
[0058] NS6: GCATCACAGACCTGTTATTGCCTC (SEQ ID NO. 2)
[0059] The amplification system is:
[0060] PremixExTaq TM II (TliRNaseHPlus) (takara) 12.5μl
[0061] NS51μl
[0062] NS61μl
[0063] DNA template 10.5μl
[0064] 25μl total
[0065] Amplification conditions
[0066] 95°C for 30 seconds-{95°C for 5 seconds-55°C for 30 seconds-72°C for 60 seconds} a total of 40 cycles-95°C for 5 seconds-60°C for 30 ...
Embodiment 2
[0068] Embodiment 2: Comparison with other extraction methods
[0069] The comparison between the method of the present invention and other fungal extraction kits is shown in Table 2, and the comparison with other methods reported in the literature is shown in Table 3.
[0070] Table 2 Comparison with other fungal extraction kits
[0071]
[0072]
[0073] Table 3 Comparison with methods reported in the literature
[0074]
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
