Method for establishing CYP2D1 gene knockout rat model
A CYP2C11, gene knockout technology, applied in the field of transgenic technology, can solve the problems of high off-target rate and poor specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] 1. Use the GeneKnock-OutwithCas9 software (provided by Nanjing Yuqi Biotechnology Co., Ltd.) to determine the selection of 3 specific sgRNA target sequences in the target site exon4 of the CYP2D1 gene (GeneID: 29277). The three target sequences are sgRNA1: CAGCATGGCCTTGGGATTGA; sgRNA2: AGACCCTTACCTCATCAGGA; sgRNA3: CTAGTTTCACCATCCTGATG. The length of CYP2D1 gene is 586bp.
[0030] 2. Construction of Cas9 plasmid expressing sgRNA
[0031] (1) Three pairs of specific sgRNA target sequence primers were synthesized in Nanjing GenScript Biotechnology Co., Ltd.:
[0032] Rat_CYP2D1_c9_1-O1: caccCAGCATGGCCTTGGGATTGA
[0033] and Rat_CYP2D1_c9_1-O2: aaacTCAATCCCAAGGCCATGCTG
[0034] Rat_CYP2D1_c9_2-O1: caccAGACCCTTACCTCATCAGGA
[0035] and Rat_CYP2D1_c9_2-O2: aaacTCCTGATGAGGTAAGGGTCT;
[0036] Rat_CYP2D1_c9_3-O1: caccCTAGTTTCACCATCCTGATG
[0037] and Rat_CYP2D1_c9_3-O2: aaacCATCAGGATGGTGAAACTAG,
[0038] (2) Mix 5 μL of upstream and downstream primers (100 μM) of sgRNA1,...
Embodiment 2
[0076] 1. Breeding of CYP2D1 knockout rats:
[0077] One F1 generation male CYP2D1 gene knockout rat heterozygote (deletion of 7bp) and two female CYP2D1 gene knockout rat heterozygote (deletion of 7bp) were housed together for breeding. Three months later, 14 offspring (F2 generation) were obtained, and the offspring were identified, and the identification results showed that one homozygous offspring was obtained, one male and one female. The obtained offspring homozygotes are used as parental cages to expand the population of homozygotes.
[0078] 2. CYP2D1 Genomic DNA Extraction and Identification
[0079] When the offspring rats were 7-14 days old, they were marked with the toe clipping method, the cut tissues were collected, lysate and proteinase K (sigma) were added, and mixed well. overnight at 55°C in a thermostatic shaking box. Add phenol: chloroform: isoamyl alcohol (volume ratio 25:24:1), and mix well. 12000r / min, centrifuge for 5min, suck the supernatant into a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 