Method for establishing CYP2D1 gene knockout rat model
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A CYP2C11, gene knockout technology, applied in the field of transgenic technology, can solve the problems of high off-target rate and poor specificity
Inactive Publication Date: 2016-06-01
JIANGSU UNIV
View PDF4 Cites 9 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, the CRISPR-Cas9 system is currently facing the problems of high off-target rate and poor specificity, which is undoubtedly the biggest challenge for the application of the CRISPR / Cas9 system in basic research and clinical treatment
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0029] 1. Use the GeneKnock-OutwithCas9 software (provided by Nanjing Yuqi Biotechnology Co., Ltd.) to determine the selection of 3 specific sgRNA target sequences in the target site exon4 of the CYP2D1 gene (GeneID: 29277). The three target sequences are sgRNA1: CAGCATGGCCTTGGGATTGA; sgRNA2: AGACCCTTACCTCATCAGGA; sgRNA3: CTAGTTTCACCATCCTGATG. The length of CYP2D1 gene is 586bp.
[0030] 2. Construction of Cas9 plasmid expressing sgRNA
[0031] (1) Three pairs of specific sgRNA target sequence primers were synthesized in Nanjing GenScript Biotechnology Co., Ltd.:
[0037] and Rat_CYP2D1_c9_3-O2: aaacCATCAGGATGGTGAAACTAG,
[0038] (2) Mix 5 μL of upstream and downstream primers (100 μM) of sgRNA1,...
Embodiment 2
[0076] 1. Breeding of CYP2D1 knockout rats:
[0077] One F1 generation male CYP2D1 gene knockout rat heterozygote (deletion of 7bp) and two female CYP2D1 gene knockout rat heterozygote (deletion of 7bp) were housed together for breeding. Three months later, 14 offspring (F2 generation) were obtained, and the offspring were identified, and the identification results showed that one homozygous offspring was obtained, one male and one female. The obtained offspring homozygotes are used as parental cages to expand the population of homozygotes.
[0078] 2. CYP2D1 Genomic DNA Extraction and Identification
[0079] When the offspring rats were 7-14 days old, they were marked with the toe clipping method, the cut tissues were collected, lysate and proteinase K (sigma) were added, and mixed well. overnight at 55°C in a thermostatic shaking box. Add phenol: chloroform: isoamyl alcohol (volume ratio 25:24:1), and mix well. 12000r / min, centrifuge for 5min, suck the supernatant into a...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention relates to a method for establishing a CYP2D1 gene knockout rat model, and belongs to the technical field of transgenosis. The method comprises the steps of firstly determining a target point of a to-be-knocked gene and designing and synthesizing a primer sequence of the gene; inserting the primer sequence into a Cas9-gRNA-Bsal carrier subjected to enzyme digestion and performing amplification to obtain a target point sgRNA with a T7 promoter sequence; after in vitro transcription and purification, performing activity detection; micro-injecting active sgRNA and Cas9 RNA into a rat single-cell embryo to obtain a Founder rat; and after screening out a CYP2D1 gene knockout rat heterozygote, performing mating to obtain a homozygote individual, namely, a CYP2D1 gene knockout rat. The invention provides a preparation method replacing a mouse model with a P450 gene knockout rat model, so that a gene knockout technology is really fused in non-clinical safety evaluation of drugs and early toxicity of candidate drugs can be discovered.
Description
technical field [0001] The invention relates to a method for establishing a CYP2D1 gene knockout rat model, which belongs to the technical field of transgenics. Background technique [0002] Cytochrome P450 (cytochrome P450), also known as mixed-function oxidase or monooxygenase, mainly exists in liver microsomes, where endogenous substances and exogenous substances including drugs and environmental compounds play a key role in the biotransformation of source substances. P450 is the phase I enzyme of drug metabolism, and its activity often plays a decisive role in the metabolism of drugs and the generation of toxic products. About 75% of drugs in the human body are metabolized by CYP. CYP1A2, CYP2C9, CYP2C19, CYP2D6, CYP2E1, and CYP3A4 in humans are related to the metabolism of 95% of existing clinical drugs, while the corresponding CYP1A2, CYP2D1, CYP2C13, CYP2D2, CYP2E1, and CYP3A1 isozymes in rats are two or more When two or more drugs are used in combination, the drug...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more