Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacillus atrophaeus strain BsR05 and application thereof

A technology of Bacillus atrophaeus and strains, applied in the field of Bacillus atrophaeus BsR05 strains, can solve the problems of difficult preservation of live bacterial preparations and difficult guarantee of shelf life, and achieve and stabilize the effect, improve the effect, and promote the effect of plant growth

Active Publication Date: 2016-06-15
BIOTECH CENT OF SHANDONG ACAD OF SCI
View PDF4 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the existing beneficial microorganisms for the prevention and treatment of gray mold are direct use of bacterial strains or bacterial agents to prevent and control diseases, such as Trichoderma, etc. However, because live bacterial preparations are not easy to preserve, their shelf life is difficult to guarantee

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus atrophaeus strain BsR05 and application thereof
  • Bacillus atrophaeus strain BsR05 and application thereof
  • Bacillus atrophaeus strain BsR05 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Identification of Bacillus atrophaeus

[0022] BsR05 was identified as Bacillus atrophaeus by 16S rDNA sequence alignment combined with determination of physiological and biochemical characteristics. Specific steps are as follows:

[0023] (1) 16SrDNA sequence analysis

[0024] Genomic DNA of BsR05 cells was extracted, PCR amplified with bacterial 16SrDNA universal primers (16sF: 5'AGAGTTTGATCCTGGCTCAG3'; 16sR: 5'TACGGCTACCTTGTTACGACT3'), and then recovered with an agarose gel recovery kit. The recovered and purified PCR product was sent to Shanghai Sangon Biotechnology Company for sequencing to obtain SEQ ID NO1:

[0025] CTGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCCGGGCCTTGTA60

[0026] CACACCGCCCGTCACACCCACGAGAGTTTGTAACACCCGAAGTCGGTGGGGTAACCTTTTT120

[0027] GGAGCCAGCCGCCTAAGGTGGGACAGATGATTGGGGTGAAGTCGTAACAAGGTAGCCGTA180

[0028] TCGGAAGGTGCGGCTGGATCACTATTGGAGAGTTTGATCCTGGCTCAGGATGAACGCTGG240

[0029] CGGCGTGCCTAATACATGCAAGTCGAGCGAATGGATTAAGAGCTTGCTCTTATGA...

Embodiment 2

[0055] Embodiment 2: the preparation of Bacillus atrophaeus (Bacillusatrophaeus) BsR05 inoculum, the steps are as follows:

[0056] (1) Incline strains: use solid LB medium, inoculate Bacillus atrophaeus (Bacillusatrophaeus) BsR05 test tube strains in the test tube culture medium, and cultivate them at a constant temperature of 30°C for 24 hours to obtain slope strains.

[0057] (2) Shake flask strains: using liquid LB medium, inoculate a single colony of slant strains in the liquid LB medium and place it on a shaker at a constant temperature of 30°C for 18 hours to obtain a seed solution.

[0058] (3) Liquid fermentation: The culture medium is: 2% corn flour, 6% soybean meal, 0.2% (NH 4 ) 2 SO 4 , 0.2%KH 2 PO 4 2H 2 O, 0.4% K 2 HPO 4 2H 2 O, 0.05%FeSO 4 ·5H 2 O, 0.3%CaCO 3 , pH7.0-7.5, sterilized at 121°C for 20 minutes, inoculated the seed liquid from step (2) in a 10-liter fermenter (2% inoculum), cultivated at 30°C, the ratio of air per minute to the volume of t...

Embodiment 3

[0060] Embodiment 3: the antagonism of Bacillus atrophaeus (Bacillusatrophaeus) BsR05 to cucumber botrytis

[0061] Pathogens to be tested: Botrytis cinerea (Botrytiscinerea Pers.exFr.) was preserved by the Institute of Biology, Shandong Academy of Sciences. Using the confrontation culture method, Botrytis cinerea was first activated on a PDA plate, and after 5 days of cultivation, it was punched with a puncher at the edge of the colony Make a 5mm pathogenic bacteria cake, transfer the pathogenic bacteria cake to the center of the PDA plate, inoculate Bacillus atrophaeus BsR05 at 2.0cm away from the bacteria cake, take the plate only inoculated with the pathogenic bacteria cake as a control, and set 3 times for each treatment. repetitions. Cultivate in an incubator at 25°C. When the blank control covers the entire petri dish, measure the control colony radius and the inhibition growth radius after inoculation with BsR05, and use the antagonistic inhibition rate (inhibition rat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Bacillus atrophaeus strain BsR05 and an application thereof. The Bacillus atrophaeus strain BsR05 is collected in the CGMCC (China General Microbiological Culture Collection Center) with the collection number being CGMCC NO.11665. A Bacillus atrophaeus strain BsR05 liquid suspending agent prepared from the strain has a specific control effect on cucumber gray mold, and the control effect is high and is averagely 70% or higher.

Description

technical field [0001] The invention relates to the technical field of agricultural microorganism control, in particular to the bacillus atrophaeus BsR05 strain and application thereof. Background technique [0002] Cucumber gray mold is a worldwide epidemic disease caused by the fungus Botrytiscinerea Pers.ex Fr., which is a disease that occurs all year round in protected cultivation of cucumbers. Heavy. Because the fruit is often infested and causes rot, vegetable farmers often call it rotten fruit disease and mildew rot disease. At present, the gray mold disease of cucumber is becoming more and more serious, resulting in a large number of rotten melons. Greenhouses with severe disease can generally reduce production by 20-30%, and even pull seedlings in advance, seriously affecting the yield and quality of cucumbers. One of the important factors causing the occurrence of gray mold of cucumber is the unreasonable combination of medicines and the resistance of cucumbers t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20A01N63/00A01P3/00C12R1/07
CPCA01N63/00C12N1/20C12N1/205C12R2001/07
Inventor 扈进冬李纪顺杨合同陈凯魏艳丽王贻莲
Owner BIOTECH CENT OF SHANDONG ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com