Bacillus atrophaeus strain BsR05 and application thereof
A technology of Bacillus atrophaeus and strains, applied in the field of Bacillus atrophaeus BsR05 strains, can solve the problems of difficult preservation of live bacterial preparations and difficult guarantee of shelf life, and achieve and stabilize the effect, improve the effect, and promote the effect of plant growth
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Identification of Bacillus atrophaeus
[0022] BsR05 was identified as Bacillus atrophaeus by 16S rDNA sequence alignment combined with determination of physiological and biochemical characteristics. Specific steps are as follows:
[0023] (1) 16SrDNA sequence analysis
[0024] Genomic DNA of BsR05 cells was extracted, PCR amplified with bacterial 16SrDNA universal primers (16sF: 5'AGAGTTTGATCCTGGCTCAG3'; 16sR: 5'TACGGCTACCTTGTTACGACT3'), and then recovered with an agarose gel recovery kit. The recovered and purified PCR product was sent to Shanghai Sangon Biotechnology Company for sequencing to obtain SEQ ID NO1:
[0025] CTGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCCGGGCCTTGTA60
[0026] CACACCGCCCGTCACACCCACGAGAGTTTGTAACACCCGAAGTCGGTGGGGTAACCTTTTT120
[0027] GGAGCCAGCCGCCTAAGGTGGGACAGATGATTGGGGTGAAGTCGTAACAAGGTAGCCGTA180
[0028] TCGGAAGGTGCGGCTGGATCACTATTGGAGAGTTTGATCCTGGCTCAGGATGAACGCTGG240
[0029] CGGCGTGCCTAATACATGCAAGTCGAGCGAATGGATTAAGAGCTTGCTCTTATGA...
Embodiment 2
[0055] Embodiment 2: the preparation of Bacillus atrophaeus (Bacillusatrophaeus) BsR05 inoculum, the steps are as follows:
[0056] (1) Incline strains: use solid LB medium, inoculate Bacillus atrophaeus (Bacillusatrophaeus) BsR05 test tube strains in the test tube culture medium, and cultivate them at a constant temperature of 30°C for 24 hours to obtain slope strains.
[0057] (2) Shake flask strains: using liquid LB medium, inoculate a single colony of slant strains in the liquid LB medium and place it on a shaker at a constant temperature of 30°C for 18 hours to obtain a seed solution.
[0058] (3) Liquid fermentation: The culture medium is: 2% corn flour, 6% soybean meal, 0.2% (NH 4 ) 2 SO 4 , 0.2%KH 2 PO 4 2H 2 O, 0.4% K 2 HPO 4 2H 2 O, 0.05%FeSO 4 ·5H 2 O, 0.3%CaCO 3 , pH7.0-7.5, sterilized at 121°C for 20 minutes, inoculated the seed liquid from step (2) in a 10-liter fermenter (2% inoculum), cultivated at 30°C, the ratio of air per minute to the volume of t...
Embodiment 3
[0060] Embodiment 3: the antagonism of Bacillus atrophaeus (Bacillusatrophaeus) BsR05 to cucumber botrytis
[0061] Pathogens to be tested: Botrytis cinerea (Botrytiscinerea Pers.exFr.) was preserved by the Institute of Biology, Shandong Academy of Sciences. Using the confrontation culture method, Botrytis cinerea was first activated on a PDA plate, and after 5 days of cultivation, it was punched with a puncher at the edge of the colony Make a 5mm pathogenic bacteria cake, transfer the pathogenic bacteria cake to the center of the PDA plate, inoculate Bacillus atrophaeus BsR05 at 2.0cm away from the bacteria cake, take the plate only inoculated with the pathogenic bacteria cake as a control, and set 3 times for each treatment. repetitions. Cultivate in an incubator at 25°C. When the blank control covers the entire petri dish, measure the control colony radius and the inhibition growth radius after inoculation with BsR05, and use the antagonistic inhibition rate (inhibition rat...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com