Kit for detecting porcine circovirus type 2
A porcine circovirus, kit technology, applied in antiviral immunoglobulins, microorganism-based methods, measuring devices, etc., can solve problems such as outbreaks
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0089] Preparation, purification and content determination of porcine circovirus type 2 cap whole protein
[0090] 1.1 Sequence and primer design of the whole Cap protein
[0091] According to the gene sequence (see sequence table SEQIDNo. .1) Design a pair of specific primers, the primer sequences are as follows:
[0092] Cap-F: 5'CATATGATGACGTATCCAAGGAGGC3',
[0093] Cap-R: 5'CTCGAGTTAAGGGTTAAGTGGGGGGT3'.
[0094] 1.2 Expression and purification of the whole Cap protein
[0095] According to Li Tingdong (Li Tingdong, Expression of Rotavirus Structural Proteins in Escherichia coli and In Vitro Assembly of Virus-like Particles, 2009), the whole Cap protein was prokaryotically expressed and purified by ion-exchange chromatography. Use 12% SDS-PAGE for protein electrophoresis, the loading amount of each lane is 10μg, the detection results are as follows figure 2 shown.
[0096] 1.3 Quantification of Cap whole protein
[0097] After protein purification, purified samples ...
Embodiment 2
[0099] Preparation, purification, identification and testing of anti-porcine circovirus type 2 cap whole protein monoclonal antibody
[0100] 2.1 Preparation and purification of monoclonal antibody against porcine circovirus type 2 Cap whole protein
[0101] 2.1.1 Animal immunization: add an equal amount of Freund's complete adjuvant to 0.5ml of porcine circovirus type 2 Cap whole protein and fully emulsify, immunize 6-8 week old BALB / c 2 healthy mice, each subcutaneously injected 300 μl of porcine circovirus type 2 Cap whole protein emulsified at multiple points, boosted once every 2 weeks, and Freund's incomplete adjuvant was used for boosting immunization; Serum, the serum titer reaches 1:20000 before fusion.
[0102] Antiserum was determined by indirect ELISA method, which consisted of the following steps:
[0103] a. Coating: Dilute porcine circovirus type 2 Cap whole protein 1:4000 (V / V) with 20mmol / L, carbonate buffer solution of pH9.6, coat 96-well polyethylene plat...
Embodiment 3
[0139] Labeling and pair detection of monoclonal antibodies
[0140] 3.1 Horseradish peroxidase (HRP) labeling of monoclonal antibodies
[0141] According to the monoclonal antibodies 2F8 and 3G12 prepared in Example 2, according to the literature of TijssenP et al. biomarker (HRP) labeling.
[0142] 3.2 Paired antibody activity detection
[0143] Select porcine circovirus type 2 PCV2-ZJ / H, dilute to 1.0ng / ml, and test different matching modes. The results are shown in Table 2:
[0144] Table 2 Monoclonal antibody collocation and activity detection
[0145]
[0146] Note: + means positive, - means negative.
[0147] The results showed that except for the monoclonal antibody 3G12 coating and HRP-labeled 2F8, the PCV2-ZJ / H virus dilution of 1.0ng / ml was negative, and all other combinations were positive. This shows that when the two monoclonal antibodies are used in pairs, the monoclonal antibody 2F8 should be coated and the monoclonal antibody 3G12 should be labeled; wh...
PUM
Property | Measurement | Unit |
---|---|---|
Titer | aaaaa | aaaaa |
Titer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com