Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for detecting porcine circovirus type 2

A porcine circovirus, kit technology, applied in antiviral immunoglobulins, microorganism-based methods, measuring devices, etc., can solve problems such as outbreaks

Active Publication Date: 2016-06-29
LUOYANG PULIKE WANTAI BIOTECH
View PDF13 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Moreover, PCV2 infection is ubiquitous clinically, but most of them manifest as recessive infection and subclinical infection, which are often overlooked. After the pigs are stressed, it may lead to the outbreak of PCV2. Diagnosis and monitoring are important for controlling PCV2 infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting porcine circovirus type 2
  • Kit for detecting porcine circovirus type 2
  • Kit for detecting porcine circovirus type 2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0089] Preparation, purification and content determination of porcine circovirus type 2 cap whole protein

[0090] 1.1 Sequence and primer design of the whole Cap protein

[0091] According to the gene sequence (see sequence table SEQIDNo. .1) Design a pair of specific primers, the primer sequences are as follows:

[0092] Cap-F: 5'CATATGATGACGTATCCAAGGAGGC3',

[0093] Cap-R: 5'CTCGAGTTAAGGGTTAAGTGGGGGGT3'.

[0094] 1.2 Expression and purification of the whole Cap protein

[0095] According to Li Tingdong (Li Tingdong, Expression of Rotavirus Structural Proteins in Escherichia coli and In Vitro Assembly of Virus-like Particles, 2009), the whole Cap protein was prokaryotically expressed and purified by ion-exchange chromatography. Use 12% SDS-PAGE for protein electrophoresis, the loading amount of each lane is 10μg, the detection results are as follows figure 2 shown.

[0096] 1.3 Quantification of Cap whole protein

[0097] After protein purification, purified samples ...

Embodiment 2

[0099] Preparation, purification, identification and testing of anti-porcine circovirus type 2 cap whole protein monoclonal antibody

[0100] 2.1 Preparation and purification of monoclonal antibody against porcine circovirus type 2 Cap whole protein

[0101] 2.1.1 Animal immunization: add an equal amount of Freund's complete adjuvant to 0.5ml of porcine circovirus type 2 Cap whole protein and fully emulsify, immunize 6-8 week old BALB / c 2 healthy mice, each subcutaneously injected 300 μl of porcine circovirus type 2 Cap whole protein emulsified at multiple points, boosted once every 2 weeks, and Freund's incomplete adjuvant was used for boosting immunization; Serum, the serum titer reaches 1:20000 before fusion.

[0102] Antiserum was determined by indirect ELISA method, which consisted of the following steps:

[0103] a. Coating: Dilute porcine circovirus type 2 Cap whole protein 1:4000 (V / V) with 20mmol / L, carbonate buffer solution of pH9.6, coat 96-well polyethylene plat...

Embodiment 3

[0139] Labeling and pair detection of monoclonal antibodies

[0140] 3.1 Horseradish peroxidase (HRP) labeling of monoclonal antibodies

[0141] According to the monoclonal antibodies 2F8 and 3G12 prepared in Example 2, according to the literature of TijssenP et al. biomarker (HRP) labeling.

[0142] 3.2 Paired antibody activity detection

[0143] Select porcine circovirus type 2 PCV2-ZJ / H, dilute to 1.0ng / ml, and test different matching modes. The results are shown in Table 2:

[0144] Table 2 Monoclonal antibody collocation and activity detection

[0145]

[0146] Note: + means positive, - means negative.

[0147] The results showed that except for the monoclonal antibody 3G12 coating and HRP-labeled 2F8, the PCV2-ZJ / H virus dilution of 1.0ng / ml was negative, and all other combinations were positive. This shows that when the two monoclonal antibodies are used in pairs, the monoclonal antibody 2F8 should be coated and the monoclonal antibody 3G12 should be labeled; wh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Titeraaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of detection of animal diseases, especially to monoclonal antibodies against the nucleocapsid protein of the porcine circovirus type 2 and a kit including the monoclonal antibody. The monoclonal kit comprises a monoclonal antibody secreted by a hybridoma cell line CCTCC No. C2014199 and / or a monoclonal antibody secreted by a hybridoma cell line CCTCC No. C2014198. The invention also provides the monoclonal antibody secreted by the hybridoma cell line CCTCC No. C2014199 and the monoclonal antibody secreted by the hybridoma cell line CCTCC No. C2014198, and provides the hybridoma cell line CCTCC No. C2014199 and the hybridoma cell line CCTCC No. C2014198.

Description

technical field [0001] The invention relates to the field of veterinary disease detection, in particular to a monoclonal antibody of porcine circovirus type 2 nucleocapsid protein and a kit thereof. Background technique [0002] Porcine circovirus (Circoviridae, Circovirus, Porcinecircovirus, PCV) is a kind of smallest animal virus found so far, known PCV has two serotypes, namely PCV1 and PCV2, wherein PCV1 has no pathogenicity, PCV2 is weaned piglet The main pathogen of multisystemic wasting syndrome (PWMS), it can not only cause failure and death of weaned piglets, but also associated with piglet A2 congenital tremor (A2CT), pig reproductive disorders, porcine dermatitis nephritic syndrome (PDNS), hyperplastic necrosis pneumonia (PNP) and respiratory disease syndrome (PRDS), collectively known as porcine circovirus disease (PCVD). The widespread prevalence of these diseases has seriously affected the development of the pig industry and brought huge losses to many countri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/577G01N33/569C07K16/08C12N5/20C12R1/91
Inventor 田克恭李凡
Owner LUOYANG PULIKE WANTAI BIOTECH