Unlock instant, AI-driven research and patent intelligence for your innovation.

A fusion protein of vasoactive intestinal peptide and its preparation method and application

A vasoactive intestinal peptide and fusion protein technology, applied in the field of vasoactive intestinal peptide fusion protein and its preparation, can solve the problems of short half-life, numerous influencing factors, complicated procedures, etc., and achieve the effect of prolonging the half-life in vivo

Active Publication Date: 2018-07-03
LANZHOU UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

One of the main obstacles to the clinical application of VIP is that it is subjected to protease action, antibody neutralization, and spontaneous hydrolysis in vivo, and its half-life is very short, which makes the half-life of VIP in vivo less than 1 minute.
[0007] Although it is disclosed in the prior art that the half-life of the target protein can be extended by the expression strategy of the fusion protein, the design of the fusion protein itself is a process with complex procedures and many influencing factors, and it is impossible to realize VIP only through the simple addition of sequences. The purpose of stably and efficiently expressing and prolonging its half-life is well known to those skilled in the art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A fusion protein of vasoactive intestinal peptide and its preparation method and application
  • A fusion protein of vasoactive intestinal peptide and its preparation method and application
  • A fusion protein of vasoactive intestinal peptide and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0074] Example 1 Construction and expression of VIP-L1-HSA fusion protein yeast expression vector

[0075] 1. Acquisition of p29-simple-VIP sequence

[0076] 1. Entrust Dalian Takara Company to synthesize the optimized VIP gene. The DNA sequence of VIP is shown in SEQ ID NO: 1, and load it into p29-simple (p29-simple plasmid vector provided by Dalian Takara Company) to obtain the vector p29- simple-VIP.

[0077] 2. Among them, p29-simple-VIP already contains L1, that is, the connecting peptide, the DNA sequence of L1 is GGCGGTGGCGGCAGCGGTGGCGGC, and the amino acid sequence is Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly.

[0078] 2. Acquisition of HSA sequence

[0079] 1. Design and synthesize PCR primers:

[0080] P1: GGTACCTCATAAGCCTAAGGCAGCTTG

[0081] P2:TCCGGAGATGCACACAAGAGTGAG

[0082] 2. PCR amplification: The DNA of the carrier pcDNA3.1-HSA was used as a template, and P1 and P2 were used as upstream and downstream primers respectively to carry out PCR amplification. The react...

Embodiment 2

[0090] Example 2 Construction and expression of HSA-L2-VIP fusion protein yeast expression vector

[0091] 1. Construction of HSA-L2-VIP fusion protein animal expression vector

[0092] 1. Acquisition of p29-simple-VIP sequence

[0093] ①. Entrust Dalian Takara Company to synthesize the optimized VIP gene. The DNA sequence of VIP is shown in SEQ ID NO: 7, and load it into p29-simple (p29-simple plasmid vector provided by Dalian Takara Company), and obtain the vector p29- simple-VIP.

[0094] ②. Among them, p29-simple-VIP already contains L2, that is, the connecting peptide, the DNA sequence of L2 is GGTGGTGGCGGCAGC, and the amino acid sequence is Gly-Gly-Gly-Gly-Ser.

[0095] 2. HSA sequence acquisition

[0096] ① Design and synthesize PCR primers:

[0097] P1:GAAGAAGCTTTGCTATGGAGACAGACACACTCCTG

[0098]P2: GAAGGAATTCGTGGTGGTGGTGGTGGTGGCAGGGAGGGCAGGTGTGGGTCTTG

[0099] ②PCR amplification: The DNA of the carrier pcDNA3.1-HSA was used as a template, and P1 and P2 were used...

Embodiment 3

[0116] Example 3: Detection of biological activity of fusion protein of vasoactive intestinal peptide

[0117] Experimental Materials

[0118] Human colon cancer cell line HT-29 was purchased from the Basic Medical Cell Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences.

[0119] ELISA kit was purchased from American R&D Company.

[0120] (1) Preparation of cell lysate

[0121] 2×105 HT-29 cells per well were plated in 24-well plates, 1 mL per well, and when the confluence of the cells reached 80%, washed once with PBS, then added 0.1 mmol / L IBMX, 500 mL per well, and after 30 min of treatment, added Pichia methanolophilus expresses the fusion protein of purified vasoactive intestinal peptide and VIP, 500uL per well, absorbs the supernatant after treatment for 30min, washes with cold PBS for 3 times, and finally washes clean, then adds appropriate cell lysate to put Freeze in a refrigerator at -20°C for 30 minutes, and slowly thaw at room tempe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering pharmaceuticals, and in particular relates to a fusion protein of vasoactive intestinal peptide, the fusion protein comprising one human serum albumin (Albumin Human, HSA) and one vasoactive intestinal peptide (VIP) , the unique amino acid sequence of the fusion protein can ensure its high-level stable expression in the host body, and while retaining the original function of VIP, the half-life in vivo is significantly prolonged. The invention also provides the preparation method of the fusion protein and its application in the preparation of medicines for anti-inflammation, anti-injury, cerebrovascular disease and improving sleep quality.

Description

technical field [0001] The invention belongs to the field of genetic engineering pharmacy, and specifically relates to a fusion protein of vasoactive intestinal peptide and its preparation method and application. Background technique [0002] Vasoactive intestinal peptide (VIP) is a polypeptide composed of 28 amino acids, mainly produced by peripheral nerves and central nervous system, released by parasympathetic postganglionic fibers, and co-exists with acetylcholine, it is considered to be Glucagon - a member of the secretin family. Widely distributed in the cholinergic presynaptic nerve cells and peripheral peptidergic nerve cells of the central nervous system, through which it can innervate various organs, such as the heart, lungs, digestive system and urogenital tract, eyes, skin, ovaries and thyroid. [0003] VIP is an important signal peptide in the central and peripheral nervous systems, and exerts physiological effects through its receptors. So far, three types of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/81A61K38/22A61K47/42A61P29/00A61P9/00A61P25/20A61P11/06C12R1/84A61K47/64
Inventor 李红玉李加忠朱红梅支德娟李洋高江利张丽芸王亚军
Owner LANZHOU UNIVERSITY