A fusion protein of vasoactive intestinal peptide and its preparation method and application
A vasoactive intestinal peptide and fusion protein technology, applied in the field of vasoactive intestinal peptide fusion protein and its preparation, can solve the problems of short half-life, numerous influencing factors, complicated procedures, etc., and achieve the effect of prolonging the half-life in vivo
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0074] Example 1 Construction and expression of VIP-L1-HSA fusion protein yeast expression vector
[0075] 1. Acquisition of p29-simple-VIP sequence
[0076] 1. Entrust Dalian Takara Company to synthesize the optimized VIP gene. The DNA sequence of VIP is shown in SEQ ID NO: 1, and load it into p29-simple (p29-simple plasmid vector provided by Dalian Takara Company) to obtain the vector p29- simple-VIP.
[0077] 2. Among them, p29-simple-VIP already contains L1, that is, the connecting peptide, the DNA sequence of L1 is GGCGGTGGCGGCAGCGGTGGCGGC, and the amino acid sequence is Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly.
[0078] 2. Acquisition of HSA sequence
[0079] 1. Design and synthesize PCR primers:
[0080] P1: GGTACCTCATAAGCCTAAGGCAGCTTG
[0081] P2:TCCGGAGATGCACACAAGAGTGAG
[0082] 2. PCR amplification: The DNA of the carrier pcDNA3.1-HSA was used as a template, and P1 and P2 were used as upstream and downstream primers respectively to carry out PCR amplification. The react...
Embodiment 2
[0090] Example 2 Construction and expression of HSA-L2-VIP fusion protein yeast expression vector
[0091] 1. Construction of HSA-L2-VIP fusion protein animal expression vector
[0092] 1. Acquisition of p29-simple-VIP sequence
[0093] ①. Entrust Dalian Takara Company to synthesize the optimized VIP gene. The DNA sequence of VIP is shown in SEQ ID NO: 7, and load it into p29-simple (p29-simple plasmid vector provided by Dalian Takara Company), and obtain the vector p29- simple-VIP.
[0094] ②. Among them, p29-simple-VIP already contains L2, that is, the connecting peptide, the DNA sequence of L2 is GGTGGTGGCGGCAGC, and the amino acid sequence is Gly-Gly-Gly-Gly-Ser.
[0095] 2. HSA sequence acquisition
[0096] ① Design and synthesize PCR primers:
[0097] P1:GAAGAAGCTTTGCTATGGAGACAGACACACTCCTG
[0098]P2: GAAGGAATTCGTGGTGGTGGTGGTGGTGGCAGGGAGGGCAGGTGTGGGTCTTG
[0099] ②PCR amplification: The DNA of the carrier pcDNA3.1-HSA was used as a template, and P1 and P2 were used...
Embodiment 3
[0116] Example 3: Detection of biological activity of fusion protein of vasoactive intestinal peptide
[0117] Experimental Materials
[0118] Human colon cancer cell line HT-29 was purchased from the Basic Medical Cell Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences.
[0119] ELISA kit was purchased from American R&D Company.
[0120] (1) Preparation of cell lysate
[0121] 2×105 HT-29 cells per well were plated in 24-well plates, 1 mL per well, and when the confluence of the cells reached 80%, washed once with PBS, then added 0.1 mmol / L IBMX, 500 mL per well, and after 30 min of treatment, added Pichia methanolophilus expresses the fusion protein of purified vasoactive intestinal peptide and VIP, 500uL per well, absorbs the supernatant after treatment for 30min, washes with cold PBS for 3 times, and finally washes clean, then adds appropriate cell lysate to put Freeze in a refrigerator at -20°C for 30 minutes, and slowly thaw at room tempe...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


