A kind of highly active chitosanase control gene csn and the method of using the gene to produce high active chitosanase

A technology of chitosanase and high activity, which is applied in the field of bioengineering, can solve the problems of low enzyme production activity, long enzyme production cycle, difficult purification treatment, etc., and achieve the conditions of mature fermentation conditions, short enzyme production cycle and improved enzyme activity. Effect

Active Publication Date: 2019-02-15
CHAMBROAD CHEM IND RES INST CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The traditional chitosanase production method is obtained by natural fermentation of wild bacteria in nature. Different strains have different fermentation conditions and fermentation forms, and the fermentation conditions of wild bacteria are immature, resulting in low enzyme production activity, long enzyme production cycle, and difficulty in purification. Disadvantages such as processing and difficult commercialization directly limit the industrial application of the process of preparing chitosan oligosaccharides by enzymatic hydrolysis. The highest enzyme activity of polycanase is 15.8U / mL; Wang Yanjun et al. isolated and identified the chitosanase-producing strain—Penicillium penicillium from the mud sample, and optimized the conditions for its enzyme production. After 72 hours of fermentation, the highest enzyme activity was 18U / mL
With the progress of science and technology, some scholars also try to use genetic engineering technology to improve the activity of chitosanase, such as Yabuki. Carbohydrase enzyme activity is up to 1051U / mL, and the enzyme activity level has been increased several times, but the various strains obtained above still cannot meet the requirements of industrialization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of highly active chitosanase control gene csn and the method of using the gene to produce high active chitosanase
  • A kind of highly active chitosanase control gene csn and the method of using the gene to produce high active chitosanase
  • A kind of highly active chitosanase control gene csn and the method of using the gene to produce high active chitosanase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Obtaining of the target gene of embodiment 1

[0038] Design the upstream primer F: GCGCCATATGAAAATCAGTATGCAAAAAGC, whose nucleotide sequence is shown in Seq ID No:3, and the downstream primer R: GCGCGAATTCTTATTTGATTACAAAATTACCGT, whose nucleotide sequence is shown in Seq ID No:4; using Bacillus cereus genomic DNA as a template , carrying out PCR amplification under the effect of Taq DNA polymerase, described Bacillus cereus genomic DNA is derived from Bacillus cereus JBSH-003, and the preservation number of this bacterial strain in China General Microorganism Culture Collection Center is CGMCC No. 6129;

[0039] Using single factor experiment and orthogonal experiment, by changing the amount of primers added in the PCR amplification system, the amount of genomic DNA and the annealing temperature (TM) of PCR amplification conditions, to determine the best PCR amplification system and conditions, in order to obtain A single, sufficient amplification product; after optim...

Embodiment 2

[0049] Embodiment 2 produces the engineering strain construction of highly active chitosanase

[0050] Choose Escherichia coli BL21 as the host strain, select pET-30b vector and csn of the target gene to construct the expression vector, first use restriction endonuclease NdeI and EcoRI to carry out double enzyme digestion at 37°C, make pET-30b vector and csn form the same The cohesive ends were then ligated using T4 DNA ligase (see Table 4 for the ligation system), and ligated overnight at 16°C.

[0051] Table 4. Expression Vector Ligation System (10μl)

[0052]

[0053] The ligation product was transformed into Escherichia coli BL21, and the bacterial solution was spread on the LB solid medium containing Kanamycin, and cultured at 37°C for 10 hours to obtain a positive transformant, that is, an engineering strain producing highly active chitosanase.

Embodiment 3

[0054] Embodiment 3 high-density fermentation obtains highly active chitosanase

[0055] The engineering bacterial strain of the production highly active chitosanase that obtains with embodiment 2 carries out high-density fermentation as bacterial classification, after the fermented bacterial liquid is through broken wall treatment, the chitosan crude enzyme liquid enzymatic activity that obtains is measured through DNS enzymatic assay method .

[0056] details as follows:

[0057] (1) Activation of strains: On a sterile operating bench, take 5 μl of frozen engineering strains producing high-activity chitosanase and inoculate them in test tubes containing LB liquid medium, and culture them at 37° C. and 150 rpm for 10 hours.

[0058] (2) Seed preparation: On the aseptic operating table, transfer the activated strains into a triangular flask containing sterilized liquid medium. The medium formula is: 1.2 parts of peptone, 2.4 parts of yeast extract, 0.4 parts of glycerol, 0.23...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of bioengineering, and provides a high-activity chitosanase controlling gene csn and a method for producing the high-activity chitosanase through the gene.The high-activity chitosanase controlling gene csn comes from bacillus cereus of which the preservation number is CGMCC No.6129, a heterologous expression vector is constructed through the high-activity chitosanase controlling gene csn and transferred into Escherichia coli BL21 of a host, and experiments show that the high-activity chitosanase can be obtained by performing high-density fermentation through the Escherichia coli BL21, and the enzyme activity is 500,000 U / g or above; in addition, the production technology is simple, the controllability is high, and the method is suitable for industrialized production.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and provides a high-activity chitosanase control gene csn and a method for producing high-activity chitosanase by using the gene. Background technique [0002] Chitin is the second largest natural polymer compound next to cellulose on the earth, and the product after deacetylation is chitosan. Chitosan contains free amino groups and is the only alkaline polysaccharide in natural polysaccharides. However, due to its poor water solubility, it is difficult to exert its due biological activity, which greatly limits the application range of chitosan. In recent years, it has been found that chitosan, the degradation product of chitosan, has unique physiological functions. Chitosan is connected by 2-20 monosaccharides through glycosidic bonds, and has good water solubility and strong biological activity (it is the same quality chitosan). More than ten times) and other advantages, known as the "s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/32C12N15/31C12N15/63C12N9/42C12R1/085
CPCC07K14/32C12N9/2434C12N15/63C12N2800/101C12Y302/01132
Inventor车树刚马韵升姚刚刘圣鹏徐泽平张心青冉新新马娜娜
OwnerCHAMBROAD CHEM IND RES INST CO LTD