Xylanase thermohaline modified mutant and application thereof

A technology of xylanase and mutant, applied in the field of genetic engineering and protein modification, can solve the problems of inactivity, inactive thermostability, etc.

Active Publication Date: 2016-08-03
YUNNAN NORMAL UNIV
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The object of the present invention is to provide a xylanase thermal salinity improved mutant and its application in view of the above-mentioned problem that low temperature enzymes are inactive at high temperature and have poor thermal stability, and most high temperature enzymes are inactive at low temperature

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Xylanase thermohaline modified mutant and application thereof
  • Xylanase thermohaline modified mutant and application thereof
  • Xylanase thermohaline modified mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Construction of mutant library

[0033] ① The genomes of Arthrobacter sp. and Lechevalieria sp. were extracted according to the instructions of the GENESTAR Bacterial Genome Extraction Kit.

[0034] ②According to the Arthrobacter sp. xylanase nucleotide sequence JQ863105 (SEQ ID No.3) recorded in GenBank, primers 5'GTGCAGCCGGAGGAAAAACG3' and 5'GATGAAGGCAGGATCCGGGGT3' were designed, and the Arthrobacter sp. genome was used as a template for PCR Amplify to obtain the xynAGN16L xylanase gene; in addition, according to the Lechevalieria sp. xylanase nucleotide sequence JF745868 (SEQ ID No.4) recorded in GenBank, design primers 5'GTCTCGGCCCCGCCGGACGT3' and 5' GGCTCGCTTCGCCAGCGTGG3', the xylanase gene xynAHJ3 was obtained by performing PCR amplification using the Lechevalieria sp. genome as a template.

[0035] ③PCR reaction parameters are: denaturation at 94°C for 5min; then denaturation at 94°C for 30sec, annealing at 55°C for 30sec, extension at 72°C for 1min30...

Embodiment 2

[0041] Example 2: Screening of Mutants

[0042] 1) Take 2 μL of bacterial liquid from the 96-well cell culture plate where the mutant library is stored, and inoculate it into 200 μL / well liquid LB culture medium (containing 100 μgmL -1 Amp) in a 96-deep-well plate at 37°C with shaking at 200rpm until OD 600 >1.0 (about 20h), add 2mMIPTG and 100μgmL -1 Amp was induced overnight at 20° C. with 160 rpm in 200 μL liquid LB culture solution.

[0043] 2) Add 40 μL / well of PopCulture after induction TM Cell lysate, shake and lyse cells at 25°C for 30 minutes.

[0044] 3) Take 50 μL of McIlvaine buffer (pH=7.0) containing 1.0% (w / v) beech xylan and 50 μL of cell lysate, and react in a 96 deep-well plate in a 70° C. incubator for 2 hours. After the reaction is over, add 150 μL of DNS reagent to terminate the reaction, incubate in a 140°C incubator for more than 20 minutes and cool to room temperature, and use a microplate reader to read the OD 540nm The value of E.coliBL21-Gold (D...

Embodiment 3

[0048] Embodiment 3: Enzyme preparation of mutant S27B05 and wild enzyme rXynAGN16L and rXynAHJ3

[0049] The recombinant strains containing mutant S27B05, wild enzymes rXynAGN16L and rXynAHJ3 were inoculated in LB (containing 100 μg mL -1 Amp) medium, shake rapidly at 37°C for 16h.

[0050] Then this activated bacterial solution was inoculated into fresh LB (containing 100 μg mL -1 Amp) culture medium, rapid shaking culture for about 2–3h (OD 600 After reaching 0.6-1.0), add IPTG at a final concentration of 0.1 mM for induction, and continue shaking culture at 20° C. for about 20 h. Centrifuge at 12000rpm for 5min to collect the bacteria. After suspending the bacteria with an appropriate amount of pH=7.0 Tris-HCl buffer solution, the bacteria were disrupted ultrasonically in a low-temperature water bath. The crude enzyme solution concentrated in the cells above was centrifuged at 13,000rpm for 10min, the supernatant was aspirated, and the target protein was affinity-purif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of genetic engineering and protein transformation, in particular to a xylanase thermohaline modified mutant and application thereof .The amino acid sequence of the mutant S27B05 is shown as SEQ ID NO.1 .Compared with wide enzymes, activity at 0 DEG C and 80 DEG C, heat stability at 37 DEG C, activity in 10.0 mM beta-Mercaptoethanol, CoCl2, MnSO4, Pb(CH3COOH)2, ZnSO4 and FeSO4, activity in NaCl of 15.0-30.0% (w / v) and stability in NaCl of 30.0% (w / v) of the mutation xylanase S27B05 are improved .The mutation xylanase S27B05 can be applied to technical fields such as food industry, aquatic feed, low-temperature and high-salt environment biont.

Description

technical field [0001] The invention relates to the technical field of genetic engineering and protein transformation, in particular to a xylanase thermosaltity improved mutant and application thereof. Background technique [0002] Xylan is the most abundant polysaccharide in hemicellulose. Xylanase can degrade xylan, which has application value in the fields of feed, food, brewing, textile and paper making. [0003] Salt-tolerant enzymes still have catalytic activity and stability under high-concentration NaCl, and can be used in high-salt food and seafood processing and other high-salt environment biotechnology fields. Processing food in a high-salt environment can also prevent microbial pollution and save The energy consumed by sterilization, etc.; heat-resistant enzymes have catalytic activity and good thermal stability at high temperatures, and have a wide range of uses, such as biomass saccharification and feed pelleting are often carried out at medium and high temper...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N15/56A23L33/17A23K20/189A23K50/80
CPCC12N9/248
Inventor周峻沛张蕊黄遵锡沈骥冬唐湘华李俊俊吴倩慕跃林
OwnerYUNNAN NORMAL UNIV