Molecular marker closely linked with melon pseudoperonospora cubensis resisting gene and application thereof

A downy mildew resistance and molecular marker technology, applied in the field of agricultural biology, can solve the problems of long genetic distance and difficult application of molecular marker-assisted breeding, so as to shorten the breeding cycle and improve the selection accuracy

Active Publication Date: 2016-08-03

XINJIANG AGRI SCI ACAD CANTALOUPE RES CENT

1 Cites 3 Cited by

AI-Extracted Technical Summary

Problems solved by technology

The molecular marker research on the source of resistance was only reported by the Zhengzhou Fruit Tree Institute of the Chinese Academy of Agricultural Sciences respectively against th...

Method used

(6) further verification by obtaining 3 pairs of primers SSR-666, SSR-689 and SSR699; with disease-resistant resources PI438685, susceptible inbred line "Karaxai", F1 and for constructing anti-sensitivity The 5 resistant F2 individual plants and 5 susceptible F2 individual plants in the gene pool were used as templates for PCR verification, and the final primer SSR-666 was amplified stably and with good repeatability. A 230bp fragment could be amplified on all of the above, and this specific band did not appear on the susceptible relatives, the susceptible gene pool and the susceptible single plant. Therefore, it is inferred that the primer SSR-666 may be related to the downy mildew resistance of the resistance source PI438685 There is a linkage relationship between the genes, named SSR-666230.

[0114] Through the test verification provided by the above-mentioned series of embodiments, the molecular markers provided by the present invention enable the assisted breeding to select clear targets and sav...

Abstract

The invention discloses a molecular marker closely linked with a melon pseudoperonospora cubensis resisting gene and the application thereof. Based on the seedling-stage resource pseudoperonospora cubensis resistance identification and selection principle and the prior art, a melon resource PI438685 with high pseudoperonospora cubensis resistance is selected as the high-resistance resource, a melon pseudoperonospora cubensis anti-fever F2-generation group is established by means of the high-resistance resource PI438685 and the susceptible farm variety Clarke, the molecular marker SSR-666230 linked with the PI438685 pseudoperonospora cubensis resisting gene is found by means of well-known heredity software, and the genetic distance between the marker and the resistance gene is 2.66 cm. By extracting genome DNA of a single melon plant and conducting PCR amplification with the marker SSR-666230, whether a unique 230bp specific band appears is detected, it is predicted that the single melon plant has pseudoperonospora cubensis resistance if yes, the technical effects of shortening breeding period and improving selection accuracy during pseudoperonospora cubensis resisting strain breeding are realized, and practical value is high.

Application Domain

Microbiological testing/measurementDNA/RNA fragmentation

Technology Topic

Agricultural scienceHigh resistance

Image

Examples

Experimental program(8)

Example Embodiment

[0062] Example 1: Molecular markers closely linked to downy mildew resistance genes in melon

[0063] A molecular marker closely linked to the melon downy mildew resistance gene specifically includes the following steps:

[0064] (1) Cross the susceptible farm variety "Karaksai" as the female parent and the disease-resistant resource PI438685 as the male parent to obtain the hybrid F 1.

[0065] (2) by hybrid F 1 Self-pollinated to obtain F 2 Generation group, F 1 Crossed with "Karaksai" to obtain backcross population BC S , F 1 Cross with PI438685 to obtain backcross population BC r.

[0066] (3) Respectively in the seedling stage to PI438685, "Karaksai", F 1 , BC S , BC r And F 2 Conduct identification of downy mildew resistance.

[0067] The inoculation solution of downy mildew fungus: collect the early diseased leaves from the field, use a soft brush to remove the sporangia on the back of the leaf, place it in a beaker filled with sterile water, and inoculate the infected leaves with a common spot method. After the cotyledon of the diseased variety is placed in a light incubator for propagation, after a large black mold layer has grown on the back of the cotyledon, then use a soft brush to remove the sporangia on the back of the leaf, and place it in a beaker filled with sterile water , After stirring, count the number of conidia with a hemocytometer, the final concentration is 5×10 3 /ml spores.

[0068] Vaccination: select PI438685, "Karaksai" and F respectively 1 40 capsules each, BC r And BC s 60 capsules each, 200 capsules F 2 Sown in a sterile nutrient bowl in a common greenhouse. When the second true leaf is fully expanded, use spray method to inoculate, the inoculation concentration is 5×10 3 Pcs/mL, spray the prepared downy mildew inoculum solution evenly on the entire leaf surface, keep moisturizing in the dark for 48 hours after inoculation, and control the temperature at night at 20°C during the day and 25°C during the day, and the relative humidity is above 90%.

[0069] According to PI438685, "Karaksai", F 1 , BC S , BC r And F 2 The results of disease resistance identification: the melon downy mildew resistance resource PI438685 carries the downy mildew resistance gene, and the resistance gene shows recessive inheritance. PI438685 is all resistant to the disease, and "Karaksai" is all susceptible, F 1 , BC S All sick, BC r The resistance ratio is close to 1:1, F 2 The medium resistance to susceptibility ratio is close to 1:3, indicating that the resistance gene of resistance PI438685 is single-gene recessive.

[0070] (4) Construction of the resistance and susceptibility gene pool of the F2 generation. Take the same amount of DNA from 5 strains of each of the disease-resistant and susceptible F2 generations, and mix them to construct the resistance and susceptibility gene pool; specifically, first select the 5 with 0-level disease resistance Take the same amount of genomic DNA to construct a disease-resistant gene pool for each individual plant, and then select 5 individual plants that are phenotypic-susceptible and draw the same amount of genomic DNA to construct a susceptible gene pool. The final concentration of the resistant pool is 100ng /mL.

[0071] (5) Use the information published by well-known primers, except for primers with no amplification product and tailing phenomenon, by using SSR primers to amplify effective bands, and use the anti-sensitive gene pool to perform SSR amplification on the primers. After screening, only 3 pairs of primers amplified stable polymorphic bands between the resistant gene pools.

[0072] (6) Through further verification of the three pairs of primers SSR-666, SSR-689 and SSR699 that have been obtained; the disease-resistant resource PI438685, the susceptible inbred line "Karaksai", F1, and the susceptible gene pool The 5 disease-resistant F2 individual plants and 5 diseased F2 individual plants were used as templates for PCR verification. The final primer SSR-666 was stable and reproducible. It can be used on the resistant parent, disease resistant gene pool and disease resistant individual plants. A 230bp fragment was amplified, and this specific band did not appear on the susceptible relatives, the susceptible gene pool, and the susceptible individual plants. It is concluded that the primer SSR-666 may be linked to the downy mildew resistance gene of the resistant PI438685 Relationship, named SSR-666 230.

[0073] (7) According to the obtained molecular marker SSR-666 230 For F 2 Amplification and detection of single plants in the next generation population, and genetic linkage analysis; genetic linkage analysis using the public genetic software QTLIciMapping, with 3.0 as the minimum LOD threshold, the melon PI438685 downy mildew resistance gene and molecular marker SSR-666 were determined 230 Close linkage, genetic linkage distance is 2.66cM.

[0074] The present invention obtains 3 pairs of primers SSR-666, SSR-689 and SSR-699 whose primer sequences are:

[0075] SSR-6665'GTTCCAATTGGGGAGATG'3;

[0076] 5'CAAATCCAACGATTCATAAAC'3;

[0077] SSR-6895'TGTGTGTGTGAGAGAGAGAG'3;

[0078] 5'GTGTTTGCCGATTCTACC'3;

[0079] SSR-6995'CAATCGCAGATACTTCCACG'3;

[0080] 5'TGCTTGTCCCAACGGTGTCAT'3.

Example Embodiment

[0081] Example 2: Molecular marker SSR-666 closely linked to the downy mildew resistance gene of melon 230 Applications

[0082] The present invention provides a molecular marker SSR-666 closely linked to the muskmelon downy mildew resistance gene 230 The application of the molecular marker SSR-666 230 Genotype testing for melon varieties or strains to determine whether the varieties or strains are resistant to melon downy mildew, including the following steps:

[0083] (1) Cross the disease-resistant resource PI438685 with other melons and reproduce to F 2 Generation above.

[0084] (2) Extract genomic DNA from a single melon plant obtained in step (1), and use SSR-666 230 This marker is amplified by PCR to detect whether only the unique 230bp specific band appears. If only this specific band appears, it is predicted that the melon plant is resistant to downy mildew.

Example Embodiment

[0085] Example 3: SSR molecular marker SSR-666 linked to the muskmelon downy mildew resistance gene 230 The acquisition.

[0086] (1) Cross the disease-resistant material PI438685 as the male parent and Xinjiang thick-skin melon "Karaksai" as the female parent to obtain F 1 , F 1 Selfing produces F 2 , F 1 Hybridize with PI438685 to get BCr, F 1 Cross with "Karaksai" to get BCs. Through the parents, F 1、 F 2 , BCr, BCs were artificially inoculated and the incidence of each individual plant was counted: BCs, F 1 And "Karaksai" all showed susceptibility, PI438685 showed resistance, and the ratio of resistance to susceptibility in BCr was approximately 1:1, F 2 The statistics of the segregated populations of generations showed that among the 197 strains, 53 strains were resistant to the disease and 144 strains were susceptible. The resistance-to-susceptibility ratio was in accordance with 1:3. Therefore, the PI438685 downy mildew resistance gene was determined to be single-gene recessive.

[0087] (2) Inoculation downy mildew and disease classification: use the method of spray inoculation of conidia suspension and 6-level disease classification, spray the spore suspension with a micro sprayer, and the concentration of the spore suspension is 5X10 3 A·mL -1 , Spray until the leaves of the plants begin to drip; after inoculation, use a small arched shed to moisturize, with a relative humidity of over 90%, open the small arched shed after 3 days, and investigate the condition after 7 days. According to the stem diseases of the plants, they were graded and the individual resistant phenotype was recorded.

[0088] 0 grade without any symptoms;

[0089] The area of grade 1 lesions accounts for less than 1/10 of the entire leaf area;

[0090] The area of grade 2 lesions accounts for 1/10-1/4 of the entire leaf area;

[0091] The area of grade 3 lesions accounts for 1/4-1/2 of the entire leaf area;

[0092] The area of grade 4 lesions accounts for 1/2-3/4 of the entire leaf area;

[0093] The diseased spots on grade 5 leaves are almost full, and the diseased spot area accounts for more than 3/4 of the entire leaf area;

[0094] The identification method adopted above refers to the common resistance classification standard of Weng Zuxin et al. (1989), and the coverage area of the mold layer on the back of the leaf is used as the statistical standard. Individuals with disease levels of 0, 1, and 2 were recorded as resistant, and individuals with disease levels of 3, 4, and 5 were recorded as susceptible.

[0095] (3) Genomic DNA extraction and DNA pool construction: Genomic DNA extraction uses CTAB method. Determination of F with Q3000UVDNAAnalizer 2 DNA concentration of a single plant, using the BSA method to mix the DNA of 5 resistant single plants and 5 susceptible single plants in equal amounts to construct a resistant pool for polymorphism screening of SSR primers; for screening polymorphisms For primer sequences, see the ICuGI website http://www.icugi.org/cgi-bin/ICuGI/misc/download.cgi.

[0096] (4) SSR-PCR reaction system: 5XPCR reaction solution 4uL; 10mmol/mL forward and reverse primers each) 1.0uL; template DNA (30ng·uL -1 )1.0uL;ddH 2 013uL, a total of 20uL PCR amplification was performed on the TC-512 thermal cycler (TECHNE). The reaction procedure is as follows: 94℃ pre-denaturation for 5 min, then 94℃ denaturation for 30s, 55℃ annealing for 45s, 72℃ extension for 2 min, and 35 cycles. Continue to extend for 10 min at 72°C and store at 4°C.

[0097] (5) Polyacrylamide gel electrophoresis detection: Take 10uL PCR reaction product and 1.5uL olfactory phenol blue (0.25%) mixed, spot on 6% polyacrylamide gel, use 1XTBE as electrophoresis buffer, stable voltage at 120V Under electrophoresis for about 1.5h. Take pictures with JY04S-3C digital gel imager.

[0098] (6) Linkage analysis: use QTLIciMapping software to analyze F 2 Perform genetic linkage analysis on the marker and resistance performance data of individual plants in the segregated population, and use Kosambi function to convert the recombination rate into genetic map distance (cM), and use QTLIciMapping software to analyze the genetic relationship between the obtained SSR markers and disease resistance genes The linkage analysis showed that the marker has a linkage relationship with the resistance gene, and its genetic linkage distance is 2.66cM, named SSR-666 230.

PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.

Classification and recommendation of technical efficacy words

Shorten the breeding cycle
Improve selection accuracy

Molecular marker closely linked with melon pseudoperonospora cubensis resisting gene and application thereof

A downy mildew resistance and molecular marker technology, applied in the field of agricultural biology, can solve the problems of long genetic distance and difficult application of molecular marker-assisted breeding, so as to shorten the breeding cycle and improve the selection accuracy

AI-Extracted Technical Summary

Problems solved by technology

Method used

Abstract

Image

Examples

Example Embodiment

Example Embodiment

Example Embodiment

PUM

Description & Claims & Application Information

Similar technology patents

Technology for cultivating hexaploid all-purple-grain wheat by utilizing distant symbiosis and epigenetic inheritance

Bamboo rat fattening method

Rapid propagation method for cyclobalanopsis glauca tissue culture

Tissue culture method of Glossostigma elatinoides

Notoginseng class sweet protein gene PnTLP5 and application thereof

Classification and recommendation of technical efficacy words

Upland cotton No. 4 chromosome and SNP molecular markers associated with fiber strength

Mandarin fish artificial advance propagation method

Method for shortening cultivation period of Fugu flavidus

Method for improving saponin content of ginseng germplasm

Method for rapidly cultivating cotton seedlings

Cultivating method of laying hen with low egg yolk cholesterol content

Field trial design method for seed selection nursery stage of sugarcane crossbreeding

Lamp shade for color sorter

Network element selection method and device

Supplier selection method and device, storage medium and electronic equipment