Carbonyl reductase ChKRED20 mutant and application thereof

A technology of reducing enzymes and mutants, applied in the fields of genetic engineering and enzyme engineering, can solve the problems of low catalytic ability of unnatural substrates and the inability of natural enzymes to adapt to industrial production conditions, and achieve good industrial application prospects, shorten the reaction cycle, and reduce time and space. The effect of improving efficiency

Active Publication Date: 2016-10-26
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF2 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Natural enzymes generally have problems such as inability to adapt to industrial production conditions and low catalytic ability to unnatural substrates in industrial applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carbonyl reductase ChKRED20 mutant and application thereof
  • Carbonyl reductase ChKRED20 mutant and application thereof
  • Carbonyl reductase ChKRED20 mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Error-prone PCR (error-prone PCR) method constructs carbonyl reductase random mutation library

[0035] use The II Random Mutagenesis kit randomly mutates the carbonyl reductase ChKRED20 gene.

[0036] The primers used were: T7: 5′–TAATACGACTCACTATAGGG–3′

[0037] T7ter: 5′–TGCTAGTTATTGCTCAGCGG–3′

[0038] The reaction conditions were: pre-denaturation at 95°C for 2 minutes, denaturation at 95°C for 30s, annealing at 55°C for 30s and extension at 72°C for 90s, a total of 25 cycles. After electrophoresis, the gene fragments were recovered with a gel recovery kit.

[0039] After the recovered fragment was digested with EcoR I and Sal I, it was ligated with the pET 28a (+) vector (kanamycin resistance gene) that had undergone the same digestion. The reaction conditions were: vector and fragment in molar ratio Mix at a ratio of 1:3, add 400 units of T4 DNA ligase, and ligate overnight at 16°C. The electric shock method was transferred into Escherichia coli DH...

Embodiment 2

[0040] Example 2 Screening of carbonyl reductase ChKRED20 mutant library

[0041] The mutant library clones in Example 1 were collected and the plasmids were extracted, transformed into Escherichia coli expression strain BL21-DE3, spread on LB plates containing kanamycin, and cultured for 12 hours. Single clones were picked and placed in a 96-well plate, each well contained 200 μL TB medium (containing 50 μg / mL kanamycin, 0.5 mM IPTG), 30° C., 180 rpm, and cultured with shaking for 18 hours. Use a 96-well plate replicator to replicate each single clone on an LB solid medium plate, culture at 37°C for 12 hours, and store in a refrigerator at 4°C. Centrifuge the 96-well plate after bacterial cell-induced expression at 4000 rpm for 10 min, discard the supernatant, add 200 μL of lysis buffer to each well to resuspend the cells (preparation of lysis buffer: 0.1 M, potassium phosphate buffer with pH 8.0, 10 mg / mL lysozyme, 1 μg / mL DNase I, 10 mM MgCl 2 ). After placing the 96-wel...

Embodiment 3

[0042] The mensuration of embodiment 3 parent and mutant specific activity

[0043] 3.1 Preparation of pure enzyme solution

[0044] The parent carbonyl reductase ChKRED20 and the mutants H145L, L205M were purified by nickel column affinity chromatography (Bio-Rad).

[0045] Pick a single clone into LB (containing kanamycin 50 μg / mL) medium, culture overnight at 37 ° C, transfer to TB (containing kanamycin 50 μg / mL) medium with 1% inoculum size, 37 Cultivate at ℃ for 3h, add 0.5mM IPTG for induction, and continue to culture at 30°C for 18h. The bacterial cells were collected by centrifugation at 4°C and 6000 rpm. Resuspended in Buffer A (50mM sodium phosphate buffer, pH 8.0, 300mM NaCl, 10mM imidazole), crushed with a homogenizer, then centrifuged at 13000rpm, 4°C for 20min, and added the supernatant to the column equilibrated with Buffer A Mix gently for 30 minutes, rinse the foreign protein with Buffer A containing 20mM imidazole, then elute the target protein with Buffer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Space-time yieldaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of gene engineering and enzyme engineering, and particularly relates to a carbonyl reductase mutant and application thereof. The carbonyl reductase ChKRED20 can realize asymmetric reduction of 2-chloro-1-(3,4-difluoro-phenyl)-ethanone to obtain a Ticagrelor intermediate (S)-2-chloro-1-(3,4-difluorophenyl)ethanol (the e. e. value is larger than 99%), and the error-prone PCR technology and the single-point saturation mutagenesis technology are utilized to realize orthogenesis of enzyme molecules to obtain 11 mutants of which the enzyme activities are improved by 1.6-10 times, so that the application potential in biocatalysis is shown.

Description

technical field [0001] The invention belongs to the technical fields of genetic engineering and enzyme engineering, and specifically relates to a carbonyl reductase mutant and its application. Background technique [0002] Optically active (S)-2-chloro-1-(3,4-difluorophenyl)ethanol is the key chiral intermediate of the drug Ticagrelor (Ticagrelor, trade name "Brilinta") developed by AstraZeneca . Ticagrelor is the first reversible P2Y approved by FDA in 2011 12 Receptor anti-blocking agent, used to prevent arteriosclerosis and treat acute coronary syndrome. [0003] Ketoreductase (EC1.1.1.X, X=1, 2) is also known as carbonyl reductase (Carbonyl reductase, CR) or alcohol dehydrogenase (Alcohol dehydrogenase, ADH), which reversibly catalyzes the reduction of ketone or aldehyde to Alcohol, and requires the participation of cofactors. Carbonyl reductases derived from microbial cells or microorganisms can efficiently catalyze the reduction of prochiral ketones, and are one of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/04C12P7/02C12P7/22
CPCC12N9/0006C12P7/22
Inventor吴中柳赵凤佼刘艳裴小琼郭超
OwnerCHENGDU INST OF BIOLOGY CHINESE ACAD OF S