Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

PCR detecting kit for fast identifying pullorum disease and chicken salmonella typhosa

A detection kit, a technology for Salmonella typhi, applied in the field of biotechnology detection, can solve the problems of time-consuming, unsuitable for routine detection, laborious and the like, and achieve a good repeatability effect

Active Publication Date: 2016-11-09
YANGZHOU UNIV
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Traditional detection methods, namely, non-selective and selective enrichment, biochemical characteristics and serological identification are laborious and time-consuming, and it takes 4-7 days to complete. Other methods, such as antibody detection, are fast, but their high false positives make them Not suitable for routine testing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR detecting kit for fast identifying pullorum disease and chicken salmonella typhosa
  • PCR detecting kit for fast identifying pullorum disease and chicken salmonella typhosa
  • PCR detecting kit for fast identifying pullorum disease and chicken salmonella typhosa

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1 bioinformatics method identifies the distribution of flhB gene

[0033] In NCBI, use the Blastn online comparison software (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to search the flhB gene in the genome-wide database, and the search results show that all pullorum and Salmonella gallinarum flhB genes The inside lacks the nucleotide sequence of 197bp, and its gene length is 83% of other serotype Salmonella flhB length ( figure 1 ).

[0034] The nucleotide sequence of pullorum and Salmonella gallinarum flhB is shown in SEQ ID NO.3, specifically:

[0035]GTGGCAGAAGAGAGCGACGACGACAAAACAGAAGCCCCCACACCCCACCGACTTGAAAAAGCGCGGGAAGAAGGGCAGATCCCCCGTTCCAGAGAACTGACCTCACTGCTGATATTGCTGGTGGGCGTTTGTATTATTTGGTTCGGCGGCGAGTCGTTAGCGCGGCAACTGGCGGGAATGCTCTCAGCAGGCCTGCACTTCGATCACCGTATGGTGAACGATCCTAACCTGATCCTGGGGCAGATAATTTTGCTGATTAAAGCGGCGATGATGGCACTGCTACCGCTCATCGCGGGCGTGGTACTGGTGGCGCTTATCTCGCCGGTTATGCTTGGCGGCCTGATTTTTAGCGGTAAGTCGCTACAGCCAAAATTTTCTAAATTAAACCCGCTGCCGGGAATTAAGCGCATGTT...

Embodiment 2

[0038] The preparation of embodiment 2 kit

[0039] Design and synthesis of primers: using the flhB gene as a template, design and analyze primers, and select the best pair of detection primers according to the genomic DNA sequence, in order to better display the intermediate fragments of the flhB gene deletion of pullorum and Salmonella gallinarum typhi The difference brought about by selecting the sequence near the missing fragment for primer design ( figure 2 ), its nucleotide sequence is shown in Table 1 below:

[0040] Table 1

[0041]

[0042] The above-mentioned primer pairs can be packaged individually, or can be made into a PCR detection solution. In the PCR detection solution, the amount of the above-mentioned primer pairs can be the conventional amount known to those skilled in the art.

[0043] That is to say, the kit of the present invention may contain the aforementioned independently packaged primer pair, or may contain a configured PCR detection solution...

Embodiment 3

[0045] Example 3 The kit detects the specific identification of pullorum and Salmonella gallinarum typhi

[0046] Using the primers in the kit described in Example 2, using the genomes of different serotypes of Salmonella and other bacteria as templates, the distribution characteristics of the flhB gene in different bacteria were identified by PCR.

[0047] The PCR reaction system is (25μL): ddH 2 O 16.25 μL, dNTP 2 μL, 10×PCR buffer 2.5 μL, flhB-F 1 μL, flhB-R 1 μL, template 2 μL, rTaq enzyme 0.25 μL.

[0048] The PCR program was 94°C for 5 minutes; 94°C for 45s, 55°C for 45s, 72°C for 30s, 30 cycles; 72°C for 10min.

[0049] The PCR product is carried out 1% agarose gel electrophoresis, and PCR electrophoresis result shows that all pullorum and Salmonella gallinarum typhi genomes all have 182bp objective band in the swimming lane of template ( image 3 ), while the amplified band of other serotypes of Salmonella was 379bp. It shows that with the specific flhB amplificatio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology detection, and particularly relates to a PCR detecting kit for fast identifying pullorum disease and chicken salmonella typhosa. The kit comprises flhB gene detection primers, and the flhB gene detection primers comprise a forward primer with the nucleotide sequence shown as SEQ ID NO.1 and a reverse primer with the nucleotide sequence shown as SEQ ID NO.2. The kit can fast identify the pullorum disease / chicken salmonella typhosa at high flux, and can be adopted as an auxiliary method for salmonella traditional serological typing, and a simple, fast and good-repeatability novel method is provided for monitoring and laboratory diagnosis of pullorum disease / chicken salmonella typhosa.

Description

technical field [0001] The invention belongs to the field of biotechnology detection, in particular to a PCR detection kit for rapidly identifying pullorum and Salmonella gallinarum typhi. Background technique [0002] Salmonellosis is one of the important infectious diseases in public health. The pathogen Salmonella belongs to Enterobacteriaceae. Eggs, livestock and meat products are the main media, which can cause a variety of livestock and poultry diseases, resulting in systemic sepsis and enteritis. Pullorum pullorum and typhoid fever are caused by Salmonella pullorum pullorum and Salmonella pullorum typhi respectively. Salmonella pullorum mainly infects 2-3 week-old chicks, causing white diarrhea with a high mortality rate, while adult chickens have a higher mortality rate after infection. It is relatively low, but it can carry and detoxify for a long time. Salmonella gallinarum typhi can be pathogenic to chicks and adult chickens, and is characterized by anemia, leuk...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/10C12R1/42
CPCC12Q1/689
Inventor 焦新安潘志明熊丹宋丽安树敏耿士忠焦扬孙林陈祥黄金林殷月兰
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com