Gene engineering bacteria producing alpha-arbutin and construction method and application of gene engineering bacteria

A technology that encodes genes and purposes, applied in genetic engineering, microorganism-based methods, applications, etc., can solve the problems of only 83% conversion rate, toxicity, and high cost

Active Publication Date: 2016-11-23
ANHUI HUAHENG BIOTECH
View PDF3 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2011, Beijing University of Chemical Technology, Deng Li used lipase to synthesize α-arbutin in the organic phase, the highest conversion rate was 95%, and the conversion time was more than 10 hours, and applied for a patent, the patent number is CN102517361A, but the adopted The solvent of the conversion solution is a toxic organic solvent
But the donor used is maltose, the cost is higher, and the conversion rate is only 83% at the same time, so it is urgent to construct a high-efficiency, safe and low-cost α-arbutin genetically engineered strain to meet the requirements of industrial production of α-arbutin needs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene engineering bacteria producing alpha-arbutin and construction method and application of gene engineering bacteria
  • Gene engineering bacteria producing alpha-arbutin and construction method and application of gene engineering bacteria
  • Gene engineering bacteria producing alpha-arbutin and construction method and application of gene engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1, the construction of the genetically engineered bacteria that produces α-arbutin

[0041] 1. Construction of a recombinant plasmid expressing amylosucrase derived from Xanthomonas campestris

[0042] In order to amplify the amylosucrase (Amylosucrase) gene XcAS derived from Xanthomonas campestris, design a pair of primers, the upstream primer is: GTGCCGCGCGGCAGCCATATG GCTAGC ATGATCGCTTCCTCCCCCATCG and downstream primer CAGTGGTGGTGGTGGTGGTG CTCGAG TCAACGACGCTGCAACCAGCGCAC.

[0043] Taking Xanthomonas campestris CGMCC 1.3408 genomic DNA as template, carry out PCR amplification with upstream primer and downstream primer, obtain the PCR amplification product that size is 1914bp, through sequencing, it is amylosucrase gene (Amylosucrase), The nucleotide sequence is sequence 1 in the sequence listing.

[0044] The PCR amplified product with a size of 1914bp was digested with NheI and XhoI, and the obtained digested product was ligated with the pET28a vector ...

Embodiment 2

[0059] The preparation of embodiment 2, α-arbutin

[0060] The genetically engineered bacteria pET28a-XcAS / BL21 obtained in Example 1 and the control bacteria pET28a-DrAS / BL21 are used as catalysts to produce α-arbutin, and the ability of these two strains of bacteria to produce α-arbutin in whole cell transformation is compared size, as follows:

[0061] 1. Preparation of α-arbutin

[0062] 1) Cultivate pET28a-XcAS / BL21 in liquid 2YT medium containing 80 μg / mL ampicillin at 37°C until the OD is 0.6, then add 0.2mM IPTG for induction, induce at 37°C for 10 hours, collect the induced products, and store at 4°C, Centrifuge at 8000 rpm for 15 minutes to collect the cells.

[0063] The above bacteria (i.e. cells), sucrose, hydroquinone, V C , TritonX-100 was added to Tris-HCl Buffer with a concentration of 100mM and a pH value of 7.0 and mixed to obtain a mixed solution; wherein, the cell concentration was 10g / L (wet weight), the concentration of sucrose was 1M, and the concent...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses gene engineering bacteria producing alpha-arbutin and a construction method and application of the gene engineering bacteria. The invention provides recombinant bacteria which are obtained by a leading amylosucrase coding gene into target bacteria; amylosucrase is derived from Xanthomonas campestris. It is proved through experiments that the amylosucrase gene derived from Xanthomonas campestris CGMCC 1.3408 is led into colibacillus to construct the gene engineering bacteria, the gene engineering bacteria are used for producing alpha-arbutin, the conversion efficiency reaches 99%, the production intensity is 7.56 g / L / h, and the highest level as reported at home and abroad so far is achieved; meanwhile, maltose which is high in price is not used as donor in the production process, and enzyme purification is not needed. In this way, the production cost of alpha-arbutin is greatly reduced, and therefore the bacterial strain can have an extremely important position in alpha-arbutin production.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a genetically engineered bacterium producing α-arbutin and its construction method and application. Background technique [0002] Arbutin is a hydroquinone glycoside compound, the chemical name is 4-hydroxyphenyl-D-glucopyranoside, which exists in bearberry, lingonberry and other plants and is a highly effective whitening active substance. Arbutin can significantly inhibit the activity of tyrosinase, thereby blocking the synthesis of dopa and dopaquinone, inhibiting the synthesis of melanin, and achieving the effect of whitening. There are two isomers of arbutin, α-arbutin and β-arbutin. In 2003, Kazuhisa et al. have found that the whitening effect of α-arbutin is more than 10 times that of β-arbutin. The IC50 of α-arbutin is 2.1mM, and the IC50 of β-arbutin is 30mM. At the same time, the biological safety of α-arbutin is better, α-arbutin will not inhibit t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12N15/54C12P19/44C12R1/19
Inventor胡美荣彭颖陶勇
OwnerANHUI HUAHENG BIOTECH