Unlock instant, AI-driven research and patent intelligence for your innovation.

Porcine ApoE gene knockout carrier as well as construction method and application thereof

A gene knockout and vector technology, applied in the field of genetic engineering, can solve the problem of low gene targeting efficiency, and achieve the effect of improving the screening efficiency

Inactive Publication Date: 2016-11-23
CHINA AGRI UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the gene targeting efficiency of somatic cells is very low, usually 10 -6 Left and right, but the target clone can still be obtained through positive and negative screening

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine ApoE gene knockout carrier as well as construction method and application thereof
  • Porcine ApoE gene knockout carrier as well as construction method and application thereof
  • Porcine ApoE gene knockout carrier as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Obtaining the long arm and short arm of the flanking sequence of the minipig ApoE gene

[0034] Design the upstream and downstream primers of the long arm Larm and short arm Sarm of the flanking sequence of minipig ApoE gene

[0035]

[0036] The long arm Larm and short arm Sarm of the flanking sequences of the minipig ApoE gene were amplified by PCR using the minipig genomic DNA as a template.

[0037] The PCR reaction for amplifying the long arm is a 20 μL reaction system: 0.6 μL of upstream and downstream primers, 1.0 μL of template DNA, 4.0 μL of 5×GCBuffer, 0.6 μL of dNTPs, 0.4 μL of KAPA Hifi Taq, sterilized ddH 2 O 12.8 μL.

[0038] PCR reaction conditions: pre-denaturation at 95°C for 5min; denaturation at 95°C for 20s, annealing at 62°C for 15s, extension at 72°C for 5min, a total of 35 cycles; 5min at 72°C.

[0039] The PCR reaction for amplifying the short arm is a 20 μL reaction system: 0.6 μL of upstream and downstream primers, 1.0 μL of temp...

Embodiment 2

[0042] Example 2 Construction of targeting vector pApoEKO-DTA-M

[0043] 1. Ligation of short arm plasmid pEASY-Sarm and targeting vector ploxp to obtain ploxp-Sarm

[0044] The targeting vector ploxp and the short arm plasmid vector pEASY-Sarm were digested with EcoRI and SalI respectively, the DNA product purification and recovery kit was used to recover the digested fragment of the ploxp vector, and the digested product of the pEASY-Sarm plasmid vector was digested with an agarose gel kit The 2.4kb short arm fragment was recovered, and after recovery, it was ligated with T4 ligase according to the ratio of ploxp plasmid and short arm fragment at 1:3, transformed into Trans-1 competent cells, picked out monoclonal sequencing identification, and carried out DNA sequencing analysis, the results showed that the short arm fragment Arm Sarm was successfully connected into the targeting vector ploxp.

[0045] 2. Ligation of long arm plasmid pEASY-Larm and ploxp-Sarm to obtain plo...

Embodiment 3

[0053] Example 3 Targeting example of vector pApoEKO-DTA-M

[0054] 1. Targeting vector transfected into fibroblasts

[0055] Linearize the pApoEKO-DTA-M plasmid by using the single enzyme cutting site ScaI in the resistance gene Amp, digest it at 37°C for 3-5 hours, and recover the target fragment by ethanol precipitation. The target fragment is dissolved in ddH 2 After O, adjust the concentration to about 1 μg / μL for later use.

[0056] 2. Cell line transfection to verify its function

[0057] Transfect the Guizhou minipig fibroblast cell line isolated from the Zhuozhou miniature pig base of China Agricultural University, and use G418-containing medium to screen the transfected cells for about 10 days to obtain resistant cell clones. Digest and select some cell clones to extract DNA for cross-long and short-arm PCR identification, use cross-short-arm primers (SARM-S-F: GGCTTTGGTTCCAGAGTTCACAGTC; CRE-NHE1-R: TTCGAGAACTGCTAGCGGATCTCGGGGCAAGACAAATGTC) PCR amplification to ide...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to porcine ApoE gene knockout carrier as well as a construction method and application thereof. The carrier is named as pApoE KO-DTA-M, and a nucleotide sequence of the carrier is as shown in SEQ ID NO: 1. The construction method comprises the following steps: (1), amplifying porcine ApoE gene flanking sequence as a long arm and a short arm of a gene target; (2), after respectively performing enzyme digestion and connection on the short arm and the target carrier ploxp, connecting the long arm; removing tk, and connecting dta gene segments; (3), inserting a specific promoter Cre between the long arm and the short arm, thereby constructing the ApoE gene knockout carrier. The porcine ApoE gene knockout carrier can be applied to breeding pigs knocked out the ApoE gene, and is applied to preparation of arteriosclerosis mode animals.

Description

technical field [0001] The invention relates to the field of genetic engineering, and relates to a porcine ApoE gene knockout vector and a construction method and application thereof. Background technique [0002] ApoE (apolipoprotein E) is an important protein molecule in lipid metabolism, mainly as chylomicron (CM), very low density lipoprotein (VLDL), intermediate density lipoprotein (IDL) and high density lipoprotein in the process of lipid metabolism An important part of (HDL). Mutations in the ApoE gene can easily lead to different types of diseases including diabetes, atherosclerosis and Alzheimer's disease (Alzheimer'sdisease, AD). ApoE knockout mice prepared by gene targeting showed aortic arch atherosclerotic plaques at 9 weeks of age under normal growth conditions, and foamy atherosclerotic plaques appeared at 7 weeks when fed with high-fat diet. In addition, the knockout mice will develop Alzheimer's disease-like lesions in the growing old stage. Therefore, us...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85A01K67/027C12N15/11C12N15/66
Inventor 李向东刘原伍李向清
Owner CHINA AGRI UNIV