Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Multiple-FIA (fluorescence immunoassay) method and kit for quickly distinguishing CDV (canine distemper virus), CPV (canine parvovirus) and RV (rabies virus)

A canine parvovirus and canine distemper virus technology, which is applied in the multiplex fluorescence immunoassay of canine parvovirus and rabies virus to detect canine distemper virus. and other problems, to achieve the effect of ensuring the renaturation temperature and hybridization efficiency, less sample consumption, and high sensitivity

Active Publication Date: 2017-01-11
GUANGDONG LAB ANIMALS MONITORING INST
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It is more complicated to establish a double or triple fluorescent quantitative PCR method. In addition to special requirements for reagents and primers, it also requires the instrument to have multiple detection channels, which greatly increases the difficulty of the experiment, and still cannot meet the needs of more samples but less sample volume. testing needs
At present, there are no relevant reports on the detection of canine distemper virus, canine parvovirus, and rabies virus using multiple immunofluorescence analysis methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiple-FIA (fluorescence immunoassay) method and kit for quickly distinguishing CDV (canine distemper virus), CPV (canine parvovirus) and RV (rabies virus)
  • Multiple-FIA (fluorescence immunoassay) method and kit for quickly distinguishing CDV (canine distemper virus), CPV (canine parvovirus) and RV (rabies virus)
  • Multiple-FIA (fluorescence immunoassay) method and kit for quickly distinguishing CDV (canine distemper virus), CPV (canine parvovirus) and RV (rabies virus)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] Example 1 Primers

[0089] After screening a large number of designed primers, it is found that the primer pairs CDV1 and CDV2, CPV1 and CPV2, RV1 and RV2 have the best effect on the detection of canine distemper virus, canine parvovirus and rabies virus by multiple fluorescent immunoassays, and their base sequences are as follows shown.

[0090] Primer CDV1: AACAGATGGGTGAAACAGCA (SEQ ID NO: 1),

[0091] Primer CDV2: GCATAACTCCAGAGCAATGGGTAG (SEQ ID NO: 2);

[0092] Primer CPV1: CAAGATAAAAGACGTGGTGTAACTC (SEQ ID NO: 3),

[0093] Primer CPV2: TTGTGTAGACGCCTCAAAAGAATAA (SEQ ID NO: 4);

[0094] Primer RV1: CAGGACTGGTATCATTTACTGGGTT (SEQ ID NO: 5),

[0095] Primer RV2: GAAGTGGATGAAATAAGAGTGAGG (SEQ ID NO: 6).

[0096] The present invention adopts the method of multiple fluorescent immunoassays to distinguish canine distemper virus, canine parvovirus and rabies virus, so the above primers are further modified to meet the corresponding operation requirements. Wherein th...

Embodiment 2

[0101] Example 2: Multiplex Fluorescence Immunoassay Kit for Rapidly Differentiating CDV, CPV and RV

[0102] The kit includes the following components:

[0103] (1) The primers designed in Example 1 for multiplex fluorescent immunoassay;

[0104] (2) Three kinds of fluorescently encoded microspheres containing anti-tag sequences that encode different fluorescent colors, and the anti-tag sequences can be complementary to the tag sequences in multiple fluorescent immunoassay primers; all three kinds of microspheres can be purchased From luminex company, CDV, CPV and RV corresponding to the fluorescent coded microsphere numbers are MTAG-A067, MTAG-022 and MTAG-034 respectively.

[0105] (3) Streptavidin-phycoerythrin complex.

[0106] (2) Three kinds of fluorescently encoded microspheres containing anti-tag sequences encoding different fluorescent colors, and the anti-tag sequences can be complementary to the tag sequences on the upstream primers of the multiple fluorescent im...

Embodiment 3

[0108] Example 3 Establishment of Multiplex Fluorescence Immunoassay Detection Method for CDV, CPV and RV

[0109] (1) Construction of CDV, CPV and RV plasmids

[0110] The nucleic acids of CDV, CPV and RV were extracted with Tiangen’s automatic nucleic acid extractor, PCR amplification was performed on CDV1 and CDV2, CPV1 and CPV2, RV1 and RV2 with primers, and the amplified products were detected by agarose gel electrophoresis And cut the gel to purify, connect the purified cDNA to the pMD-19T vector respectively, transform the ligated products into DH5a competent cells, select single clones, carry out colony PCR identification, and carry out plasmid extraction on the colonies identified as positive bacteria, Send for sequencing.

[0111] (2) Plasmid PCR amplification

[0112] The primers described in Example 1 were used to carry out single-fold and triple-fold PCR amplification of CDV, CPV and RV, respectively.

[0113] Preparation of upstream primer mixture: mix CDV1, C...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a multiple-FIA (fluorescence immunoassay) method and kit for quickly distinguishing CDV (canine distemper virus), CPV (canine parvovirus) and RV (rabies virus). The operation is simple, a target amplified fragment is obtained through a PCR (polymerase chain reaction), then an amplification product, fluorescence coded microspheres and streptavidin-phycoerythrin are hybridized, the MFI (mean fluorescence intensity) value is read through a detector, and different types of pathogens are distinguished. The method can be used for detecting and distinguishing the CDV, CPV and RV simultaneously, has the advantages of high specificity, high sensitivity, good repeatability and the like and can realize simultaneous detection of various different target molecules in the same sample. The method is good in flexibility, and the type of detected pathogens can be increased or decreased on the basis as required.

Description

technical field [0001] The invention belongs to the field of pathogen detection in dog breeding, and in particular relates to a multiple fluorescence immunoassay method for detecting canine distemper virus, canine parvovirus and rabies virus. Background technique [0002] Canine distemper virus (CDV), canine parvovirus (CPV), and rabies virus (Rabies virus, RV) are several important pathogens for the outbreak and prevalence of canine viral infectious diseases. The clinical fatality rate after mixed infection can reach 50% to 100%, causing serious economic losses to the dog industry. Canine distemper caused by CDV infection mainly includes four types: respiratory type, digestive type, neurological type and mixed type, which can cause systemic immunosuppression in infected animals, and the fatality rate is extremely high. The symptoms caused by a single CPV infection in the body are mild, and the synergistic mixed infection with other viruses and bacteria can cause very obvio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/6816C12Q1/701C12Q2600/16C12Q2563/107C12Q2537/143C12Q2563/149
Inventor 郭鹏举伍妙梨丛峰练月晓黄韧张钰
Owner GUANGDONG LAB ANIMALS MONITORING INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com