Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of gibberellin biosynthetic enzyme to acceleration of plant maturing

A technology of biosynthesis and gibberellin, applied in the field of crop breeding and plant genetic engineering, can solve the problems of shortening the growth cycle of plants and early plant maturity.

Active Publication Date: 2017-02-22
HANGZHOU RUIFENG BIOTECH LIMITED
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are no relevant reports or patents about shortening the plant growth cycle and early plant maturation by specifically regulating the key enzymes of the GA biosynthetic pathway.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gibberellin biosynthetic enzyme to acceleration of plant maturing
  • Application of gibberellin biosynthetic enzyme to acceleration of plant maturing
  • Application of gibberellin biosynthetic enzyme to acceleration of plant maturing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Construction of corn GA biosynthetic enzyme gene ZmGA20ox1 overexpression vector

[0046] The acquisition of the genome sequence of the ZmGA20ox1 gene expression cassette (the nucleotide sequence is shown in SEQ ID NO.8): design PCR primers ZmGA20OX1-geno-F: CCCAAGCTTCTGCCATGACGTGATTGTCCCTGG and ZmGA20OX1-geno-R: CCCAAGCTTCGCCACCGTCACGTGTCCAAGAT, using the commercial corn variety Zhengdan 958 genome As a template, a presumed 3.8kb genome fragment including ZmGA20ox1 gene promoter, expression sequence and terminator sequence was obtained by PCR amplification. The PCR reaction conditions were: 95°C for 3 minutes; 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 4 minutes, repeating 33 cycles; and then 72°C for 10 minutes.

[0047] Construction of the Agrobacterium T-DNA vector: the binary vector pCambia1300-p35S-G10 vector (Internationl Pat.No.PCT / CN2012 / 087069:SEQ ID NO.47) contains a glyphosate-resistant gene (EPSPS) (as transformed marker gene), p35S promo...

Embodiment 2

[0048] Example 2 Construction of corn GA biosynthetic enzyme gene cDNA overexpression vector

[0049] 1. Cloning of cDNA

[0050] Obtaining the cDNA of GA biosynthetic enzyme gene ZmGA20ox1 in maize: PCR primers ZmGA20ox1-F (5'GGGATCCAACAATGGTGCTGGCTGCGCACGA) and ZmGA20ox1 (5'TGGGCCCTTACTACTTCTTCTCCAGCAGGTGCTGTCCGC) were designed, and the 5' end of ZmGA20ox1 was obtained by PCR amplification using the genome of commercial maize variety Zhengdan 958 as a template sequence. The PCR reaction conditions were: 95°C for 3 minutes; 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 80 seconds, repeating 30 cycles; and then 72°C for 10 minutes. The obtained PCR product of about 1.3 Kb was cloned into the T-vector pMD19. The primers ZmGA20ox1-MF (5'GGGCGAGGGATACCGGCACCACGGGGAGGT) and ZmGA20ox1-MR (5'GGTGCCGGTATCCCTCGCCCAGCTTGTCCAC) were further used for point mutation to remove the KpnI site inside the promoter. Finally, the corresponding cDNA was obtained by double digestion with B...

Embodiment 3

[0057] Embodiment 3, transformation of corn

[0058] Maize transformation technology is relatively mature. References such as: Vladimir Sidorov & David Duncan (in M. Paul Scott (ed.), Methods in Molecular Biology: Transgenic Maize, vol: 526; Yuji Ishida, Yukoh Hiei & Toshihiko Komari (2007) Agrobacterium-mediated transformation of maize. Nature Protocols 2: 1614- 1622. The basic method is as follows:

[0059] Hi-II corn ears 8-10 days after pollination were taken, and all immature embryos (1.0-1.5 mm in size) were collected. 将含有T-DNA载体(pCambia1300-ZmGA20ox1(geno)-p35S-pZmUbi-1174;pCambia1300-pZmTE1-ZmGA20ox1-p35S-pZmUbi-1174;pCambia1300-pZmTE1-ZmGA20ox 2-p35S-pZmUbi-1174;pCambia1300-pZmGA20ox1-ZmGA20ox1 -p35S-pZmUbi-1174; pCambia1300-pZmGA20ox1-ZmGA20ox2-p35S-pZmUbi-1174) Agrobacterium and immature embryos on co-cultivation medium (MS+2mg / L 2,4-D+30g / L sucrose+3g / L agar (sigma 7921)+40mg / L acetosyringone) for 2-3 days (22°C). Transfer immature embryos to callus induction m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a gibberellin biosynthetic enzyme to acceleration of plant maturing. The application includes that a gibberellin biosynthetic enzyme gene is linked with an expression element to construct an expression cassette, and the expression cassette is transferred into a plant to promote plant grain filling so as to accelerate plant maturing. The novel application of the GA (gibberellins) biosynthetic enzyme gene has the advantages that through overexpression of the GA biosynthetic enzyme gene in corn, the plant growth cycle can be shortened effectively, the grain filling efficiency of crops can be improved to accelerate plant maturing, and the mature period can be accelerated by at least one day and by 1-30 days preferably; the crop rotation efficiency can be improved effectively, costs can be reduced and the overall productivity can be increased.

Description

[0001] (1) Technical field [0002] The present invention belongs to the field of plant genetic engineering. Specifically, the present invention relates to a kind of plant promoter and the method of using this kind of promoter to control plant gibberellin (GA) metabolic enzyme gene, expressing in plant to obtain mature early transgenic plant method. The invention can be applied in the field of crop breeding. [0003] (2) Background technology [0004] The growth cycle of a plant is the entire process from seed germination, development into a mature plant, flowering, and seed formation. The growth cycle of crops is mainly determined by the variety and climate, and different varieties are suitable for growing in regions with different climates. For example, Northeast China is suitable for growing corn varieties with a short growth cycle. At the same time, under the condition of equivalent yield, the shorter the crop growth cycle, the more times of sowing and harvesting in the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84C12N15/53A01H5/00
Inventor 张先文沈志成王东芳林朝阳
Owner HANGZHOU RUIFENG BIOTECH LIMITED
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com