A sipunculus nudus plasmin cDNA gene, a recombined plasmin and applications of the recombined plasmin
A technology of square starworm and plasmin, which is applied in the field of genetic engineering and can solve the limitations of the preparation process and the inability to produce in large quantities.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Cloning of the full-length cDNA gene of Plasmolysin
[0023] Experimental material: square starworm, from the seaside of Danzhou, Hainan;
[0024] Reagents: Trizol reagent (Invtrogen), RACE 5’ / 3’ Kit, T-Vector pMD19, MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0, MiniBEST Plasmid Purification Kit Ver.4.0, Premix Taq TM , E.coli DH5a Competent Cells, DL2000Marker (TAKARA), primer synthesis and gene sequencing (Sangon Bioengineering Co., Ltd., Shenzhen BGI Technology Service Co., Ltd.).
Embodiment approach
[0025] The specific implementation method is as follows:
[0026] (1) Acquisition of the nucleotide sequence of the conserved middle fragment of the plasminus gene
[0027] Search the plasmin gene of serine trypsin family through NCBI, find the conserved sequence and design the degenerate primers.
[0028] Upstream primer ER: '5'-aac agg gtc ctg tgc gcn gcn cay tg 3', (degeneracy 32, Tm=60.9)
[0029] Downstream primer BF: '5'-ggg ccg ccg gag tcn ccr ttr ca 3', (degeneracy is 16, Tm=62.5)
[0030] Synthesis of the first strand cDNA of the fibrinolytic enzyme of the phalaenopsis: the phalaenopsis was placed in seawater for 24 hours, and the sediment in the digestive tract was drained. Nitrogen was ground into powder, total RNA was extracted by TRIzol method, and stored in a -70°C refrigerator. use RACE 5' / 3' Kit for reverse transcription experiments, add 5ul total RNA, 1ul 5' / 3'CDS Primer A, 4ul 5×First-Stand Buffer, 0.5uL DTT (100mM), 1.0uldNTPs (20mM ), 0.5ul RNase Inhi...
Embodiment 2
[0050] Eukaryotic Expression of Plasmina Gene
[0051] Experimental materials: pGAPZaA vector, Pichia pastoris GS115 (Invtrogen); BTXECM830 Electroporation System;
[0052] Reagents: ECORI, QuickCut TM Xba I, Premixed Protein Marker Low, DL5000Marker, DL2000Marker (TAKARA), AvrII (NOVA), BCA Protein Assay Kit (Kangwei Century).
[0053] (1) Target fragment amplification:
[0054] According to the pGAPZaA vector map, add ECORI and Xba I restriction enzyme sites (underlined) at both ends of the target gene, and design primers as follows:
[0055] Primer name Primer sequence
[0056] EC primer: 5'CCG GAATTC ATGGGGACGTCACACCGGACT 3'
[0057] XB primer: 5’TGC TCTAGA GTTGGAGTCAATCCAGCTACG 3’
[0058] On the ice bath, add 1ul of cDNA full-length gene fragment, 1uL of EC and XB primers, 2×Premix Taq TM 25uL, 22uL of sterilized water were mixed in a PE tube, and the PCR reaction was carried out: pre-denaturation, 94°C, 3min, (denaturation at 94°C, 30s, annealing at 56°C, 30S,...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



