Supercharge Your Innovation With Domain-Expert AI Agents!

A sipunculus nudus plasmin cDNA gene, a recombined plasmin and applications of the recombined plasmin

A technology of square starworm and plasmin, which is applied in the field of genetic engineering and can solve the limitations of the preparation process and the inability to produce in large quantities.

Active Publication Date: 2017-03-15
HAIKOU EXPERIMENTAL STATION CHINESE ACAD OF TROPICAL AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above-mentioned published patent reports all extract fibrinolytic enzymes from the natural Aurantia phalaenopsis, so they are limited by the supply of raw materials, resulting in the inability to produce in large quantities, and the preparation process has limitations.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A sipunculus nudus plasmin cDNA gene, a recombined plasmin and applications of the recombined plasmin
  • A sipunculus nudus plasmin cDNA gene, a recombined plasmin and applications of the recombined plasmin
  • A sipunculus nudus plasmin cDNA gene, a recombined plasmin and applications of the recombined plasmin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Cloning of the full-length cDNA gene of Plasmolysin

[0023] Experimental material: square starworm, from the seaside of Danzhou, Hainan;

[0024] Reagents: Trizol reagent (Invtrogen), RACE 5’ / 3’ Kit, T-Vector pMD19, MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0, MiniBEST Plasmid Purification Kit Ver.4.0, Premix Taq TM , E.coli DH5a Competent Cells, DL2000Marker (TAKARA), primer synthesis and gene sequencing (Sangon Bioengineering Co., Ltd., Shenzhen BGI Technology Service Co., Ltd.).

Embodiment approach

[0025] The specific implementation method is as follows:

[0026] (1) Acquisition of the nucleotide sequence of the conserved middle fragment of the plasminus gene

[0027] Search the plasmin gene of serine trypsin family through NCBI, find the conserved sequence and design the degenerate primers.

[0028] Upstream primer ER: '5'-aac agg gtc ctg tgc gcn gcn cay tg 3', (degeneracy 32, Tm=60.9)

[0029] Downstream primer BF: '5'-ggg ccg ccg gag tcn ccr ttr ca 3', (degeneracy is 16, Tm=62.5)

[0030] Synthesis of the first strand cDNA of the fibrinolytic enzyme of the phalaenopsis: the phalaenopsis was placed in seawater for 24 hours, and the sediment in the digestive tract was drained. Nitrogen was ground into powder, total RNA was extracted by TRIzol method, and stored in a -70°C refrigerator. use RACE 5' / 3' Kit for reverse transcription experiments, add 5ul total RNA, 1ul 5' / 3'CDS Primer A, 4ul 5×First-Stand Buffer, 0.5uL DTT (100mM), 1.0uldNTPs (20mM ), 0.5ul RNase Inhi...

Embodiment 2

[0050] Eukaryotic Expression of Plasmina Gene

[0051] Experimental materials: pGAPZaA vector, Pichia pastoris GS115 (Invtrogen); BTXECM830 Electroporation System;

[0052] Reagents: ECORI, QuickCut TM Xba I, Premixed Protein Marker Low, DL5000Marker, DL2000Marker (TAKARA), AvrII (NOVA), BCA Protein Assay Kit (Kangwei Century).

[0053] (1) Target fragment amplification:

[0054] According to the pGAPZaA vector map, add ECORI and Xba I restriction enzyme sites (underlined) at both ends of the target gene, and design primers as follows:

[0055] Primer name Primer sequence

[0056] EC primer: 5'CCG GAATTC ATGGGGACGTCACACCGGACT 3'

[0057] XB primer: 5’TGC TCTAGA GTTGGAGTCAATCCAGCTACG 3’

[0058] On the ice bath, add 1ul of cDNA full-length gene fragment, 1uL of EC and XB primers, 2×Premix Taq TM 25uL, 22uL of sterilized water were mixed in a PE tube, and the PCR reaction was carried out: pre-denaturation, 94°C, 3min, (denaturation at 94°C, 30s, annealing at 56°C, 30S,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a sipunculus nudus plasmin cDNA gene, a recombined plasmin and applications of the recombined plasmin and belongs to the technical field of genetic engineering. The sipunculus nudus plasmin cDNA gene sequence and the amino acid sequence thereof are shown as SEQ ID NO:1 and SEQ ID NO:2. The cDNA sequence encodes 834 nucleotides, namely 277 amino acids. Through a pGAPZaA vector, the sipunculus nudus plasmin cDNA gene is transferred into a pichia pastoris GS115 strain to perform secretory expression. The recombined plasmin can directly dissolve fibrin in thrombi, and can be used for preparing thrombolytic medicines to treat thrombotic diseases.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a cDNA gene of the spirochete fibrinolytic enzyme, the recombined fibrinolytic enzyme of the spiky sparrow and an application thereof. Background technique [0002] Thromboembolic disease is a common cardiovascular and cerebrovascular disease, often manifested as myocardial infarction, ischemic cerebral infarction, and venous thromboembolism. With the improvement of people's living standards and the arrival of population aging, cardiovascular and cerebrovascular diseases have replaced cancer as the number one cause of death in my country. At present, thrombolytic drugs are used clinically to reduce the mortality and disability rate of patients with thrombosis, but the existing thrombolytic drugs still have shortcomings such as short half-life, easy bleeding and re-embolization. It is one of the research directions for the treatment of cardiovascular and cerebrovascular...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/57C12N9/68A61K38/48A61P7/02
CPCA61K38/00C12N9/6408C12Y304/21007
Inventor 马伏宁郭刚谭琳金志强马蔚红臧小平郭素霞殷晓敏孙佩光
Owner HAIKOU EXPERIMENTAL STATION CHINESE ACAD OF TROPICAL AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More