Unlock instant, AI-driven research and patent intelligence for your innovation.

A molecular marker related to boar sperm motility traits and its application

A technique for sperm motility and boars, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve problems such as insufficient sperm motility, azoospermia, and sperm morphology defects

Active Publication Date: 2020-12-04
HUAZHONG AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Multiple studies in humans and animals have shown that mutations in the PRM2 gene are associated with male sterility (Aoki VW et al., Identification of novel polymorphisms in the nuclear protein genes and their relationship with human sperm protamine deficiency and severe male infertility.Fertility and sterility.2006 ,86:1416-1422; Aston KI et al.,Evaluation of 172 candidate polymorphisms for association with oligozoospermia orazoospermia in a large cohort of men of European descent.Human reproduction(Oxford,England).2010,25:1383-1397;Ravel C et al., Mutations in the protamine 1gene associated with male infertility. Molecular human reproduction.2007,13:461-464), and in the study of mice, it was found that individuals with Prm2 gene deletion haplotype had defects in sperm morphology, insufficient sperm motility and low The phenomenon of sperm or even no sperm (Cho C et al., Haploinsufficiency of protamine-1 or-2 causes infertility in mice. Nature genetics. 2001, 28:82-86; Cho C et al., Protamine 2deficiency leads to sperm DNA damage and embryo death in mice .Biology of reproduction.2003,69:211-217; Seki Y et al.,Cellular dynamics associated with the genome-wide epigenetic reprogramming in migrating primordial germ cells inmice.Development (Cambridge,England).2007,134:2627-2 638)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular marker related to boar sperm motility traits and its application
  • A molecular marker related to boar sperm motility traits and its application
  • A molecular marker related to boar sperm motility traits and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1, the screening of PRM2 gene SNPs

[0025] 1.1 Extraction of Landrace boar sperm total DNA by phenol extraction

[0026] Take 1mL of semen, put it in a 2mL centrifuge tube, centrifuge at 5000rpm for 7 minutes, discard the supernatant; add 1000uL normal saline to each centrifuge tube, pipette repeatedly, mix well, centrifuge at 12000rpm for 7 minutes, discard the supernatant; repeat the above washing steps 1-2 times; add 1000uL sperm lysate (800uL double distilled water, 20uL 0.5M EDTA solution, 10uL 1M Tris-Cl solution, 100uL 10% SDS solution, 20uL β-mercaptoethanol, 20uL 5M NaCl solution) and 15-20uL of proteinase K (10mg / mL), fully blown and mixed, digested at 55°C overnight (about 12h); add about 1000uL of phenol with an equal volume of sample to each centrifuge tube, vigorously invert and shake for 10 minutes to fully mix the two phases until Form a milky white yellowish emulsion, centrifuge at 12000rpm at 4°C for 15 minutes, transfer the supernatant to...

Embodiment 2

[0037] Example 2 Establishment of PCR-RFLP detection method for PRM2 gene

[0038] 2.1 Primer sequence

[0039] A primer pair for the PRM2g.287G>A site was designed to detect the polymorphism of the variable site in the population. The sequence of the primer pair is as follows:

[0040] Forward primer PRM2_SNP-F 5'CTCTGGGCAGCAGCGCGAAA 3',

[0041] Reverse primer PRM2_SNP-R 5'CCTTCCGCACCCTGGTCTGGA 3'.

[0042] 2.2 PCR amplification conditions

[0043] The total volume of the PCR reaction is 10 μl, including about 50ng of Landrace pig genomic DNA, 5ul of 2x Taq PCR Mix (purchased from Beijing Aidelai Biotechnology Co., Ltd.), 0.2ul of the forward primer described in 2.1 above (final concentration 0.02pmol / ul ), reverse primer 0.2ul (final concentration 0.02pmol / ul), Landrace boar genomic DNA 1ul (final concentration 5ng / ul). PCR amplification program: 94°C for 5min, 30×[94°C for 30s, 71°C (-0.5°C / cycle) for 30s, 72°C for 15s], 10×(94°C for 30s, 61°C for 30s, 72°C for 15s), ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of livestock molecular marker preparation, and concretely relates to a molecular marker related to a sperm activity character of a boar and application. The molecular marker is screened from a PRM2 gene; a nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 1. An allelic mutation R exists in nucleotide in position 169 of a sequence table, R is G or A, and the mutation causes the polymorphism of NaeI-RFLP. The invention further discloses a primer pair for amplifying PRM2 gene SNP (Single Nucleotide Polymorphism), and the primer pair is also the primer pair for detecting the screened molecular marker provided by the invention. The invention builds a method for detecting the polymorphisms of the sperm activity character of the boar. Association analytic application shows that the molecular marker provided by the invention can be used as the marker for assistant selection of the sperm activity character of the boar.

Description

technical field [0001] The invention belongs to the technical field of screening and application of pig molecular markers, and in particular relates to a molecular marker related to boar sperm motility traits and its application. The molecular marker screened in the present invention is cloned from the PRM2 gene. Background technique [0002] The pig industry plays a pivotal role in my country's agriculture. In 2015, the number of pigs slaughtered nationwide reached 708.25 million heads, ranking first in the number of pigs slaughtered in the world during the same period. my country has become a veritable pig-raising country. Improving the fertility of boars is the key to pig production, and sperm motility is the main manifestation of the fertility of boars. Studies have shown that the sperm motility of breeding boars is extremely significantly correlated with the litter size and live piglets of Large White, Landrace and Duroc sows, and the sperm density is also related to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 刘榜薄东东张宇陈曦李家连徐学文
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More