Neuropeptide Corazonin and acceptor gene thereof as well as applications to specific control agent of Bactrocera dorsalis

A technology of Bactrocera dorsalis and neuropeptides of Bactrocera dorsalis, applied in the field of genetic engineering, can solve the problems of less research and application of Bactrocera dorsalis

Inactive Publication Date: 2017-05-10
SOUTHWEST UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few reports on new pesticides targeting GPCRs in insects, and even less research and application in Bactrocera dorsalis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Neuropeptide Corazonin and acceptor gene thereof as well as applications to specific control agent of Bactrocera dorsalis
  • Neuropeptide Corazonin and acceptor gene thereof as well as applications to specific control agent of Bactrocera dorsalis
  • Neuropeptide Corazonin and acceptor gene thereof as well as applications to specific control agent of Bactrocera dorsalis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1. Obtaining the Open Reading Frame Sequence of Bacteralis dorsalis Neuropeptide Corazonin and Its Receptor

[0042] 1. Primer design and amplification of the open reading frame sequence of Bacteralis dorsalis neuropeptide Corazonin and its receptor Corazonin receptor

[0043]Based on genome and transcriptome data, using bioinformatics methods, after repeated comparison and analysis of Drosophila neuropeptide Corazonin (Genbank No.NP_524350.1) and Drosophila neuropeptide receptor Corazonin receptor (GenbankNo.AF373862.3), The nested PCR-specific primers for the Bactrocera dorsalis neuropeptide Corazonin and its receptor were designed, and the sequences are as follows:

[0044]

[0045] The total RNA of B. dorsalis was extracted with an RNA extraction kit, and reverse transcribed into cDNA with a reverse transcription kit.

[0046] Amplify the Bacteralis dorsalis neuropeptide Corazonin sequence: 50 μL reaction system contains 24 μL deionized water, 20 μL 2×Pr...

Embodiment 2

[0058] Example 2. Determination of the binding ability of Bacteralis dorsalis neuropeptide Corazonin and its receptor Corazonin receptor based on the method of intracellular calcium ion flow detection

[0059] 1. Construction of CHO cell (Chinese hamster ovary cell) expression plasmid of Bactrocera dorsalis Corazonin receptor

[0060] The Bacteralis dorsalis neuropeptide Corazonin receptor plasmid and the pcDNA3.1 (+) plasmid that are connected to the T vector that are recovered in Example 1 are connected (T4 DNA ligase) after NotI single enzyme digestion respectively, after connection The transformation was carried out with reference to the transformation method in Example 1. After the positive identification of the bacterial liquid was correct (PCR detection was performed with the universal primer T7 / BGH, T7: TAATACGACTCACTATAGGG, BGH: TAGAAGGCACAGTCGAGG), the plasmid was extracted with a plasmid extraction kit, and the constructed The pcDNA3.1(+) plasmid of the Corazonin re...

Embodiment 3

[0075] The results of the detection of the binding ability of the synthesized ligand polypeptide to the Corazonin receptor are as follows: figure 1 As shown, it is shown that the ligand BdCZ has the ability to activate the receptor, while the control BmAKH (polypeptide sequence: Cys-Glu-Leu-Thr-Phe-Ser-Pro-Asp-Thr-NH2) has no activity on the receptor . Among them, the EC50 value (concentration in the maximum luminescence value) of BdCZ is 52.5nM respectively. In this way, BdCZ was identified as the model ligand. Example 3. Determination of Silencing Efficiency of Bacteralis dorsalis Neuropeptide Receptor Corazonin Receptor Based on RNA Interference Method

[0076]1) Extract the total RNA of B. dorsalis with an RNA extraction kit, reverse transcribe it into cDNA with a reverse transcription kit, and use the cDNA as a template to perform PCR amplification using primers containing the T7 promoter. The reaction conditions are: Pre-denaturation at 95°C for 3min; denaturation at ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides Bactrocera dorsalis neuropeptide gene Corazonin and an acceptor gene thereof Corazonin receptor as well as amplification methods, coded proteins and applications. The Bactrocera dorsalis neuropeptide Corazonin gene is shown in a SEQ ID No.9, and coded protein is shown in SEQ ID No.10; the invention also provides a nucleotide sequence of a Bactrocera dorsalis neuropeptide Corazonin ligand as shown in SEQ ID No.11, and coded protein is shown in SEQ ID No.12; the Bactrocera dorsalis neuropeptide acceptor Corazonin receptor gene is shown in SEQ ID No.13, and coded protein is shown in SEQ ID No.14; the invention also provides applications of nucleotide and amino acid sequences.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a neuropeptide Corazonin, its receptor gene and its application in Bactrocera dorsalis specific control agent. Background technique [0002] Bactrocera dorsalis (Bactrocera dorsalis, Hendel), also known as Bactrocera orientalis, yellow fly, fruit maggot, belongs to Diptera Diptera, Bactrocera Tetriphitidae, this insect has a strong ability to adapt to the environment and the ability to invade and spread. There are more than 250 kinds of fruit trees, vegetables and flowers in 46 families such as citrus, guava, mango, etc., which have caused great harm to the healthy development of my country's fruit, vegetable and flower industries. At present, many countries and regions such as Europe, the United States, Japan and Southeast Asia have listed B. dorsalis as an important dangerous quarantine object. In the control of Bactrocera dorsalis, chemical insecticides are an im...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/435C07K14/72C12N15/10A01N57/16A01P7/04
CPCA01N57/16C07K14/43577C07K14/723C12N15/1096C12Q2531/113C12Q2549/119
Inventor 蒋红波侯秋莉陈二虎
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap