An aptamer for detecting lactoferrin content and its application

A technology for lactoferrin and protein content, which is used in measurement devices, material excitation analysis, fluorescence/phosphorescence, etc., can solve the problems of complex pretreatment process, low sample recovery rate, poor stability, etc., and achieve high sensitivity and anti-interference. Strong, avoid false positive signal effect

Active Publication Date: 2019-07-26
NANJING UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the detection techniques suitable for lactoferrin in different types of biological samples mainly include spectrophotometry, high performance liquid chromatography, enzyme-linked immunosorbent assay, high performance affinity chromatography, high performance capillary electrophoresis and surface plasmon resonance technology. However, these methods still have the characteristics of complex pretreatment process, low recovery rate of actual samples, and poor stability. important and urgent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An aptamer for detecting lactoferrin content and its application
  • An aptamer for detecting lactoferrin content and its application
  • An aptamer for detecting lactoferrin content and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Lactoferrin aptamer screening

[0024] The specific steps of lactoferrin aptamer screening, including chip preparation, positive and negative screening process, PCR amplification and other detailed processes, are as follows, wherein:

[0025] Library: 5′-TAMRA-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3′

[0026] TARMA modified forward primer: 5′-TARMA-GACAGGCAGGACACCGTAAC-3′

[0027] Biotinylated backward primer: 5′Biotin-GAAGAGGAGGGAGGTAGCAG-3′

[0028] (1) Chip preparation: First, use the combination of photolithography mask and chemical etching to make a microfluidic channel template as a PDMS channel to make a mold; then weigh the PDMS prepolymer with a mass ratio of 10:1 and solidify The reagents were fully mixed, vacuumed, poured onto the microfluidic channel template and cured to obtain a PDMS microfluidic channel; use a spotting instrument to spot a lactoferrin and negative protein microarray with a concentration of 5 mg / mL on the glass substra...

Embodiment 2

[0035]Embodiment 2: Fluorescence polarization method detects lactoferrin standard sample:

[0036] (1) In 10 μL, 250 nM FITC (fluorescein isothiocyanate) labeled aptamer N2 (base sequence: AGGCAGGACACCGTAACCGGTGCATCTATGGCTACTAGCTTTTCCTGCCT) solution, add 100 μL of lactoferrin standard sample with a concentration of 25 μg / mL, fully Mix well.

[0037] (2) The mixture in step (1) was placed in a 96 microwell plate and reacted at 37 °C for 15 min, and scanned directly with a BioTeK microplate reader with an excitation wavelength of 480 nm and an emission wavelength of 528 nm.

Embodiment 3

[0038] Embodiment 3: optimization of reaction time of fluorescence polarization method

[0039] (1) In 10 μL, 250 nM FITC (fluorescein isothiocyanate) labeled aptamer N2 (base sequence: AGGCAGGACACCGTAACCGGTGCATCTATGGCTACTAGCTTTTCCTGCCT) solution, add 100 μL of lactoferrin standard sample with a concentration of 25 μg / mL, fully Mix well.

[0040] (2) Put the mixture in step (1) in a 96 microwell plate and react at 37 °C for 5 min, 10 min, 15 min, 20 min, 25 min, 30 min, 35 min, 40 min, 45 min respectively , 50 min, 55 min, 60 min, directly scanned with a BioTeK microplate reader, the excitation wavelength is 480 nm, and the emission wavelength is 528 nm.

[0041] figure 1 It is the graph of the fluorescence polarization signal and the fluorescence polarization signal in the blank solution under different time conditions.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses an aptamer used for detecting lactoferrin content, and the nucleotide sequence of the aptamer is shown as SEQ ID NO.5-65. The invention also discloses a method for detecting the lactoferrin by the aptamer. According to the method, a fluorescently-labeled aptamer is taken as a probe molecule, and through the specific binding of the aptamer and the lactoferrin, a fluorescence polarization signal is changed. The fluorescence polarization signal and lactoferrin concentration have a linear relationship so as to realize the quantitative detection of the lactoferrin. The method has the advantages of high sensitivity and good specificity, and a detection linear range is 0.78-50 mu g / mL. According to the method, the measurement, such as the measurement of the lactoferrin in milk, of a target object in a complex sample can be realized. In addition, according to the method, a BioTeK microplate reader is used for directly scanning a 96 pore plate to achieve the requirement of quick and high flux measurement, and a plurality of samples can be simultaneously effectively measured.

Description

technical field [0001] The invention belongs to the technical field of biological detection, and in particular relates to an aptamer for detecting lactoferrin by using a fluorescence polarization method and an application thereof. Background technique [0002] Fluorescence polarization technology, as a simple and reliable means of signaling, can provide information about molecular orientation, migration and interaction processes based on changes in the molecular mass of fluorophores. Fluorescence polarization analysis has many advantages: first, it is a homogeneous analysis method with high sensitivity, without complex operations such as separation, and the results are reproducible; second, the response time is fast, and intermolecular interactions can be monitored in real time ; Third, it can be used in conjunction with instruments such as microplate readers to realize automatic high-throughput determination; Fourth, the fluorescence polarization depends on the ratio of the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N21/64
CPCG01N21/6445
Inventor许丹科李慧陈竹刘晓辉
OwnerNANJING UNIV