Vero cell line for stably expressing bovine trypsinogen (S.pro-try) and purpose thereof

A bovine trypsin and cell line technology, applied to cells modified by introducing foreign genetic material, medical preparations containing active ingredients, enzymes, etc., can solve the difficulty of increasing cell culture, accelerate multi-cycle growth of viruses, and improve Vaccine production costs and other issues, to achieve the effect of simplifying the virus culture process, increasing the virus yield, and simplifying the production process

Inactive Publication Date: 2017-05-31
NAT INST FOR FOOD & DRUG CONTROL
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Trypsin belongs to the serine protease family, and its C-terminal serine peptidase domain with a length of 220aa can specifically hydrolyze HA0 of human influenza virus or low pathogenic avian influenza virus, so that the mature HA1 and HA2 can release the virus genome into the cell, Accelerate the multi-cycle growth of the virus, but at the same time, the addition of trypsin also increases the difficulty of cell culture and increases the cost of vaccine production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vero cell line for stably expressing bovine trypsinogen (S.pro-try) and purpose thereof
  • Vero cell line for stably expressing bovine trypsinogen (S.pro-try) and purpose thereof
  • Vero cell line for stably expressing bovine trypsinogen (S.pro-try) and purpose thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Construction and Identification of the Bovine Pancreatin Gene Eukaryotic Expression Vector of Recombination Optimization in Example 1

[0041] (1) Vector construction: using the bovine trypsinogen cDNA sequence provided by GenBank (Genbank LOC780933, namely SEQ ID No.1) as a template, design specific primers, upstream primer CCC GCCACCATGAAGACCTTCATCTTTC (SEQ ID No.2), downstream primer CCG TTAGTTGGAGGACATGGTCTGC (SEQ ID No.3), amplified to obtain the expression sequence of the secreted zymogen, and simultaneously introduced a single restriction site in the upstream and downstream respectively, the upstream primer was introduced into EcoR I (shown in italic underline), and the downstream primer was introduced into Xho I ( Italic underlined), adding the Kozak sequence GCCACC to the N-terminus of the initiation codon ATG of the upstream primer to improve the expression efficiency. In a 50 μl PCR reaction system, 5 μl of amplification template, 32.8 μl of sterilized dou...

Embodiment 2

[0044] Example 2 Screening and identification of monoclonal cells stably expressing secretory trypsinogen Vero

[0045] (1) Selection of the appropriate G418 concentration in the screening medium: inoculate Vero cells into a 24-well plate and add G418 when the confluence is 70%, so that the concentration is 0 μg / ml, 200 μg / ml, 400 μg / ml, 600 μg / ml , 800μg / ml, 900μg / ml, 1000μg / ml, 1100μg / ml, duplicate wells for each concentration, placed at 37°C, 5% CO 2 Cultivate in an incubator, observe and record cell death every day, change the medium every 3-4 days, draw a cell survival curve after two weeks of cultivation to determine the minimum lethal concentration of G418, and determine the concentration of G418 in the Vero cell pressure screening medium in the experiment. 600μg / ml, the maintenance solution concentration is 300μg / ml.

[0046] (2) G418 pressurized selection and limiting dilution method for screening monoclonal cells: inoculate Vero cells into a 6-well plate, culture un...

Embodiment 3

[0048] Example 3 Proliferation of influenza virus on Vero cells stably expressing bovine trypsinogen

[0049]Monoclonal cells VTY55 and normal Vero were inoculated in 6-well cell culture plates to 90% confluence, aspirated off the cell culture medium, washed cells with sterile PBS 3 times to remove FBS, replaced with serum-free DMEM containing 1% double antibody and incubated at 37°C Cultivate in the box for 24 hours, and wait for the expression and accumulation of the zymogen of the monoclonal cells. After 24 hours, each subtype of influenza virus was inoculated, and the trypsin group was added with a final concentration of 0.5 μg / ml TPCK-Trypsin (TPCK-Trypsin) at the same time. After mixing, they were cultured in a 37°C 4% CO2 incubator. Freeze and thaw the cells twice at 48h, 72h, and 96h respectively to release the virus, centrifuge at 5000rpm at 4°C for 10min to remove cell debris, collect the supernatant virus liquid, and detect the virus NA activity. Results: The monoc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Vero cell line for stably secreting and expressing bovine trypsinogen (S.pro-try) and application thereof to influenza virus culture and influenza virus vaccine production. The Vero cell line is named as VTY55, has the preservation number of CGMCC No.12680, and belongs to the technical field of biology. The invention also provides a method for building the Vero-S.pro-try cell line. The Vero-S.pro-try monoclonal cell line VTY55 provided by the invention has the advantages that on one hand, the cell foundation is laid for the large-scale influenza vaccine production in future, and the crucial problems of vaccine productivity expansion and quality improvement can be solved; on the other hand, the cell line can also be used as a study tool in other aspects such as laboratory effective ingredient separation culture, influenza virus monitoring, anti-influenza-virus medicine screening, neutralizing antibody determination and the like; wide application prospects are realized.

Description

technical field [0001] The present invention relates to the field of biotechnology, specifically, the present invention relates to engineering cell line cloning Vero-S.pro-try and its construction method, and the use of said cell line in cultivating influenza virus, preparing influenza vaccine, screening anti-influenza virus drugs, And antibody determination or other related research on influenza and other applications. Background technique [0002] Influenza vaccine is currently the most effective means of preventing the occurrence and spread of influenza. Most of the human influenza vaccines currently on the market are produced on chicken embryos, including influenza A H1N1, H3N2 and influenza B strains. The traditional chicken embryo production system has a history of nearly 70 years. The immune effect of the vaccine has been fully confirmed, but it still has some shortcomings. For example, the cultured influenza virus is prone to antigenic variation and cannot be comple...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10C12N15/85C12N9/76C12N7/00A61K39/145A61P31/16C12R1/91
CPCC12N9/6427A61K39/12C12N7/00C12N15/85C12N2760/16134C12N2760/16151C12N2760/16234C12N2760/16251C12N2800/107C12Y304/21004
Inventor江征朱秀娟李长贵
OwnerNAT INST FOR FOOD & DRUG CONTROL