Preparation method of sensitive cell subcloning Vero/Slam/V for enhancing PPRV (Peste Des Petits Ruminants Virus) duplication
A technology of sensitive cells and cells, applied in the direction of genetically modified cells, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problems of low isolation rate, limit PPRV wild virus strains, virus loss, etc., and reach the disease time. The effect of shortening, improving the separation rate of PPRV, and simplifying the steps
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] 1. Design and synthesize primers for the Slam / V functional region of the goat signaling lymphocyte activation molecule. The primers match the P site of the vector and can perform homologous recombination, that is, have a B site homology arm. The sequence is as follows:
[0040] SEQ ID NO.1: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGCTAGATCTGCGGAAAGGTGACT,
[0041] SEQ ID NO. 2: GGGGACAACTTTTGTATACAAAGTTGTGGCATGCTGAGGGCCAAGAGTGAG.
[0042] 2. Preparation of Goat Signaling Lymphocyte Activation Molecular RNA Template
[0043] The peripheral blood lymphocytes of healthy goats were collected and isolated, and their total RNA was extracted.
[0044] 3. Preparation of DNA of Slam / V functional region
[0045] Amplify the Slam / V functional region and establish a 50ul amplification system as follows:
[0046]
[0047] Click and mix the above to carry out RT-PCR amplification. The reaction conditions are:
[0048]
[0049] 4. Slam / V entry carrier construction
[0050] Gel reco...
Embodiment 2
[0066] 1-7 steps are with embodiment 1.
[0067] 8. Verification of slam / V gene expression in Vero / slam / V functional region cells by indirect immunofluorescence at the protein level
Embodiment example 1
[0068] The positive vero / slam / V functional region positive cell subclones screened in step 7 in Example 1 were inoculated on a 6-well cell culture plate with flyers added in advance, and after culturing for 48 hours, the flyers were taken out and washed with PBS buffer (pH7.6) Wash the cell surface twice, drain the liquid, add pre-cooled 80% acetone, put it in a -20°C refrigerator for 25 minutes, discard the acetone, and wash the monolayer cells three times with PBST buffer (pH 7.6). Block with PBS blocking solution containing 3-5% BSA for 45 min at room temperature. Discard the blocking solution and wash the cells 3 times with PBS. Goat anti-Slam primary antibody (Santa Cruz Biotechnology Co., Ltd.) diluted 1:200 in PBS was added to each well, reacted in a 37°C humid chamber for 1 hour, the primary antibody was discarded, and the monolayer cells were washed 3 times with PBST buffer. Add 1:500 dilution of FITC fluorescein isothiocyanate-labeled donkey anti-goat IgG to each we...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com