Kit for direct PCR (polymerase chain reaction) detection on porcine contagious pleuropneumonia pathogen and application thereof

A pleuropneumonia and infectious technology is applied in the field of kits and their applications, in the field of kits for direct PCR detection of infectious pleuropneumonia pathogens in pigs, which can solve the problems of inaccurate results, poor sensitivity, time-consuming and laborious, and reduce false The effect of being positive, improving detection, and reducing the chance of occurrence

Pending Publication Date: 2017-05-31
INST OF ANIMAL HUSBANDRY & VETERINARY MEDICINE HENAN ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it takes at least 3-4 days from bacterial isolation and culture to purification and DNA extraction to make a preliminary identification, which is not only time-consuming and laborious, but also inaccurate, and has poor sensitivity, which is prone to false positive results, which is not conducive to farmers and large-scale enterprises. Take appropriate serotype vaccines and drugs for timely treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for direct PCR (polymerase chain reaction) detection on porcine contagious pleuropneumonia pathogen and application thereof
  • Kit for direct PCR (polymerase chain reaction) detection on porcine contagious pleuropneumonia pathogen and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] The kit of the direct PCR detection pig contact infectious pleuropneumonia pathogen of the present embodiment, composition comprises:

[0019] (1) Lysis solution: 2-4M isothiocyanate, 7-10M ethylenediaminetetraacetic acid, 15-20M lauryl sarcosine, 3-6% (volume ratio) polyvinylpyrrolidone.

[0020] (2) PCR amplification reagent: 5×PCR Buffer, 2.0M dNTP, 10pM forward primer, 10pM reverse primer, high-fidelity Taq enzyme (5U / μl), 20mM MgCl 2 ,pure water.

[0021] The specific composition of each ingredient:

[0022] The reaction system is 25 μl, the lysed sample is 5 μl, APPF (5′-CAAGCTATCAAATAAGGCGAAACTA-3′) (10pmol / μl) 2μl, APPR (3′-AGTATCCGTATCAAGAAGAAG-5′) (10pmol / μl) 2μl, 5×PCR Buffer 5μl , 2.0mM / L dNTPs 5μl, high-fidelity Taq enzyme 0.5μl (5U / μl), 20mM MgCl 2 3.5μl, 2μl purified water, mix thoroughly and centrifuge briefly.

[0023] One pair of specific primers is as follows: APPF: CAAGCTATCAAATAAGGCGAAACTA, APPR: AGTATCCGTATCAGAAGAAG.

[0024] The kit is used ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a kit and application thereof, in particular to a kit for direct PCR (polymerase chain reaction) detection on porcine contagious pleuropneumonia pathogen and application thereof, and belongs to the technical field of biology. The kit comprises the following reagents including lysate, PCR amplification regents, a positive control and a negative control. The kit can be used for fast and accurately detecting the porcine contagious pleuropneumonia pathogen. During the application, single samples infecting porcine contagious pleuropneumonia can be detected; the mixed infection in clinic cases can also be realized; the kit can be used for the porcine contagious pleuropneumonia pathogen general survey, molecular epidemiological investigation and vaccine screening and monitoring.

Description

technical field [0001] The invention relates to a kit and application thereof, in particular to a kit for direct PCR detection of pig contact infectious pleuropneumonia pathogen and application thereof, belonging to the field of biotechnology. Background technique [0002] Porcine contact contagious pleuropneumonia, also known as necrotizing pleuropneumonia, is an acute respiratory infectious disease caused by Actinobacillus pleuropneumoniae (APP), characterized by acute hemorrhagic fibrinous pneumonia and chronic fibrinous necrotizing pleuritis . The case fatality rate of the acute patient is high, and the chronic patient can often endure it. Pigs of all ages can be infected with porcine contact infectious pleuropneumonia, usually 2-5 months old and weighing 30-60kg. Actinobacillus pleuropneumoniae is a respiratory parasite with high host specificity to pigs. Acute infection can not only be seen in lung pathological changes and blood, but also a large number of bacteria e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12Q1/04C12R1/01
CPCC12Q1/686C12Q1/689C12Q2531/113C12Q2565/125
Inventor 李海利郎利敏方剑玉王克领张立宪游一侯自花
Owner INST OF ANIMAL HUSBANDRY & VETERINARY MEDICINE HENAN ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap